Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577274 in the current build, Tomato 200607 #2

Unigene SGN-U333585

Unigene Basic Information

Unigene ID:	SGN-U333585
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	333585
mRNA sequence:	Length: 322 bp

>SGN-U333585 Tomato 200607 #1 (1 members)
GATGCTTCACTTACCATGGTCATGGGAGATGACATGGTTAAGGTTATTGCTTGGTATGACAATGAATGGGGCTATTCACAGAGGGTCGTT
GATCTCGCTAACATTGTTGCCAACCAATGGATATGAAAAAGCTCTTATCTATTAATTAAATATTAGCTTAACTTTTTTGCCTTATCTGTA
GATTATATTGCTCCCCTTTCTGAAAATTGTAACCATCGAGAACCCAGACAGATTTCTATTCTTAATTTGTATAATATCATCAATTCATTT
CAAATGTTTCGTGATCCATCTTTAGTATCCAGAGCTTAAATAGTGAGCATCC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E290989
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 0 )

Protein prediction analysis (3)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101545	Glyceraldehyde 3-phosphate dehydrogenase - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity (GO:0004365) - Biological Process: glycolysis (GO:0006096) - Molecular Function: NAD binding (GO:0051287) Glyceraldehyde-3-phosphate dehydrogenase type I - Biological Process: glucose metabolism (GO:0006006) - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase activity (GO:0008943) - Molecular Function: NAD binding (GO:0051287)	78
2	118512	Glyceraldehyde 3-phosphate dehydrogenase - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity (GO:0004365) - Biological Process: glycolysis (GO:0006096) - Molecular Function: NAD binding (GO:0051287) Glyceraldehyde-3-phosphate dehydrogenase type I - Biological Process: glucose metabolism (GO:0006006) - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase activity (GO:0008943) - Molecular Function: NAD binding (GO:0051287)	71
5	129168	Glyceraldehyde 3-phosphate dehydrogenase - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity (GO:0004365) - Biological Process: glycolysis (GO:0006096) - Molecular Function: NAD binding (GO:0051287) Glyceraldehyde-3-phosphate dehydrogenase type I - Biological Process: glucose metabolism (GO:0006006) - Molecular Function: glyceraldehyde-3-phosphate dehydrogenase activity (GO:0008943) - Molecular Function: NAD binding (GO:0051287)	34

Preceding Unigenes (1)

Unigene	Build
SGN-U225514	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer