Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U593373 in the current build, Tomato 200607 #2

Unigene SGN-U333603

Unigene Basic Information

Unigene ID:	SGN-U333603
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	333603
mRNA sequence:	Length: 568 bp

>SGN-U333603 Tomato 200607 #1 (1 members)
GATTCCCTTTCTCTCTCTGAAGAAAATCATTGATTAGATTCGTTGTGTAGATTTTGGTTATCTGCAGTTTTTGTTTTTCATTTTAAATTT
GTGAATCGAGAGTGTATACGAATTTATTCAAGGAAAACACTTTTAGGAGCTTTTGTTGATCCTTCAATGGCCGCACCACCGGCGAGGGCT
AGAGCAGACTATGATTATCTCATTAAGCTTCTTTTGATCGGCGATAGTGATGATCGATTGACAATTTATCAGGGCCCTATCACTCTAATG
GATATGGCGAGGGATATATTTTTACTTGGTGTTGGTAAGAGTTGTCTTCTTTTACGTTTCTCTGATGGTTCCTTCACCACAAGCTTCATC
ACAACTATCGGAATTGATTTTAAAATTCGAACCATTGAGCTTGATGGAAAAAGAATCAAGCTTCAGATATGGGATACAGCTGGTCAGGAA
CGTTTTCGGACCATCACTACTGCTTACTATCGTGGAGCCATGGGTATACTGTTGGTGTATGATGTAACTGATGAATCCTCCTTTAACAAC
ATCAGGAACTGGATTCGTAACATTGAGC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
er43	ethylene-responsive small GTP-binding protein

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E310376
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118418	Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	280
5	128935	Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) Ras small GTPase Rab type - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) - Biological Process: protein transport (GO:0015031)	203

Preceding Unigenes (1)

Unigene	Build
SGN-U232557	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer