This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U588507 in the current build, Tomato 200607 #2
Unigene SGN-U333677

Unigene Basic Information 
Unigene ID: SGN-U333677
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 333677
mRNA sequence: Length: 575 bp

>SGN-U333677 Tomato 200607 #1 (1 members)
GCTCTACTGAACAAAGTTTTCGATTTAATCAGTATTATAAGTTGCAATAAAAATGGAATTCCTTTGTTTAGCCCCAACACGTAGTTTTTC
CACCAATCCCAAATTAACAAAAAGTATTCCTAGCGATCATACTAGTACCACGAGTCGTATTTTCACATACCAAAACATGCGTGGCTCAAC
GATGAGACCATTAGCGTTGCCGTTAAAAATGTCACCAATTGTTTCTGTGCCGGATATTACAGCTCCGGTGGAAAATGTTCCGGCTATCTT
GCCAAAAGTCGTTCCCGGAGAGTTGATAGTGAATAAACCAACGGGGGGCGATAGCGATGAATTGTTTCAATATTTAGGTGATGTAGTTCT
TTATGGTAAAACATTTGATGAAGCTCAAACACACGCGCTGGAATTGAGTGAAAAAGACGGGCTCAAATACATCCCACCATTCGATGATCC
AGGAGTCATCAAAGGCCAAGGTACAATTGGAACAGAGATAAACCGTCAACTGAAGGACATTCACGCTGTGTTTATACCTGTTGGTGGTGG
GGGTTTGATAGCTGGTGTTGCTACCTTTTTCAAAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
td threonine deaminasethreonine deaminase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E331555
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)