This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U593370 in the current build, Tomato 200607 #2
Unigene SGN-U334095

Unigene Basic Information 
Unigene ID: SGN-U334095
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 334095
mRNA sequence: Length: 730 bp

>SGN-U334095 Tomato 200607 #1 (1 members)
GATTAATATATATTATTGGCCCTTCACCTTCGCAGGAAGCTCAACACAAATCTGTCATCACTGTGCAATCTCGTGTCAACCTAAGTAGCA
GAAAAATGGCTCCAATCGCCGTTGGTGACGTCATCCCCGATGGTACCGTATCTTACTTCGACGAGCAAGATCAGATGCAGACCGTCTCAG
TATACTCACTTGCTAAGGGCAAGAAGGTCATCATCTTCGCCGTTCCCGGAGCTTTCACTCCCACTTGCAGCATGAAGCATGTGCCTGGCT
TTATTGAAAAGGCTGCTGAGTTGAAGTCAAAGGGTGTCGATGAAATCCTCTGCATCAGTGTCAATGACCCCTTTGTGATGAAGGCCTGGG
CAAAAACTTACCCTGAGAACAAACATGTAAAATTTCTTGCTGATGGAGCTGGAAAATACACCCATGCCCTTGGGCTGGAGCTTGATCTGT
CGGATAAGGGGCTTGGTGTTCGATCACGAAGGTATGCTCTTTTGGTTGATGACCTTGAGGTGAAAGTAGCTAACATTGAATCTGGAGGGG
AGTTCACGGTCTCCGGTGCTGATGAAATCGTCAATGCTCTTTAAGCTTATCACTACTGCCTCCCAAGTGTTCTGGCTCTACAATGAGCTT
CTAGAATCTATGCCAATAATGTTTTTGATATATCTGTAGTCGCTAATATCAAACTTTGTATGAAGAATGCTTTGTGGAAATAAGAATTTC
TTGCTTTAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
tpx1 thioredoxin peroxidase 1thioredoxin peroxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E720326
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None