Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U593384 in the current build, Tomato 200607 #2
Unigene SGN-U334096

Unigene Basic Information 
Unigene ID: SGN-U334096
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 334096
mRNA sequence: Length: 539 bp

>SGN-U334096 Tomato 200607 #1 (1 members)
GCACTGTGCAATCTCGTGTCAACCTAAGTAGCAGAAAAATGGCTCCAATCGCCGTTGGTGACGTCATCCCCGATGGTACCGTATCTTACT
TCGACGAGCAAGATCAGATGCAGACCGTCTCAGTATACTCACTTGCTAAGGGCAAGAAGGTCATCATCTTCGCCGTTCCTGGAGCTTGAT
CTGTCGGATAAGGGGCTTGGTGTTCGATCACGAAGGTATGCTCTTTTGGTTGATGACCTTGAGGTGAAAGTAGCTAACATTGAATCTGGA
GGGGAGTTCACGGTCTCCGGTGCTGATGAAATCGTCAATGCTCTTTAAGCTTATCACTACTGCCTCCCAAGTGTTCTGGCTCTACAATGA
GCTTCTAGAATCTATGCCAATAATGTTTTTGATATATCTGTAGTCGCTAATATCAAACTTTGTATGAAGAATGCTTTGTGGAAATAAGAA
TTTCTTGCTTTACTAATGTGTTGGAGGCAAAGAAACTGGCAATATGTAAAATTACTCTGGGGTGAGGTGTGGACAGTAGCGTTGTAACT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
tpx1 thioredoxin peroxidase 1thioredoxin peroxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E347644
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)