Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579140 in the current build, Tomato 200607 #2

Unigene SGN-U334120

Unigene Basic Information

Unigene ID:	SGN-U334120
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	334120
mRNA sequence:	Length: 473 bp

>SGN-U334120 Tomato 200607 #1 (1 members)
GCACAATTGTGATGTGCCACATGTCAACCGTACCGACTATCAGCTGATTGATATCTCTGAAGATGGTTTTGTCTCCCTTCTTACTGAAAG
TGGAAACACCAAGGATGACCTCAGGCTTCCCACCGATGAAAATCTGCTGAAGCAGGTTAAAGATGGGTTCCAGGAAGGAAAGGACCTTGT
GGTGTCTGTAATGTCTGCGATGGGCGAAGAGCAGATTAACGCCGTTAAGGATGTTGGTACCAAGAATTAGTTATGTCATGGCAGCATATA
ATCACTGCCAAAGCTTTAAGACATTATCATATCCTAATGTGGTACTTTAATATCACTATATTATAAACTGTGTTATTTGCACTGTTGAAA
ACAAAAGAAAGAAAACTGCTGTTATGGCTAGAGAAAGTATTGGCTTTGAGCTTTTGACAGCACAGTTGAACTATGTGAAAATTCTACTCT
TTTTTCTTCTTTTTTTTTTGGGT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
tif5a2	translation initiation factor 5A-2

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E712571
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101744	Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Translation protein SH3-like KOW	41
2	118632	KOW Translation protein SH3-like Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676)	41
5	129106	KOW Translation protein SH3-like Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676)	40

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer