Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579359 in the current build, Tomato 200607 #2
Unigene SGN-U334146

Unigene Basic Information 
Unigene ID: SGN-U334146
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 334146
mRNA sequence: Length: 2144 bp

>SGN-U334146 Tomato 200607 #1 (1 members)
GAAATCAATTTCATTCAACAACACATTGTGAAAAAACAAAAACTTCATTTTCTTCTTCATAGCTAGAAAATCTCTATCAGATTCAGCAAT
GCGGCCTCCTAGCCGGGGCGTATTAATTTCTTTTTTCGTTATTACTCTTTTGTCTTACCAGATCTCGTATGTGGTAGGACAAGAAGGTGA
TAGCGATATCGGATTAGATGACATTAAGGCTAATGCTAGTAAGTTGAGTTTTGAAAACTCAAGGACTCGCGATGCTTATATCGCGTTGCA
GTATTGGAAAACAGCAATGTTTTCTGATCCTTTTAACTTCACAGCTAATTGGACAGGTCCAAATGTGTGTTCCTATGGTGGAGTGTTTTG
TGCTCCTTCGTTAATGGATGATTCGATTAGAGTTGTAGCTGGCATTGATCTTAATCATGCTGATATTGCTGGTTCATTAGTTGCAGAACT
CGGTCTTCTTACAGATCTGGTTCTTTTCCATCTCAACTCGAATCGTTTTTGTGGAGTTGTACCAAAAACCTTTAGCCATTTGAAGCTTCT
TAGGGAGCTTGATTTGAGTAATAATAGGTTTGTTGGTGGGTTTCCTAAGGTAGTTCTTTCACTACCTTCTTTGAAGTTTTTGGATCTAAG
GTTTAATGACTTTGAAGGACCAGTTCCTTCAGGACTTTTCGATAAAGATTTGGATGCGTTGTTTTTGAATGACAATAGATTCCGTTTTGG
CATCCCGGAGAACTTGGGTAACTCTCCTGTTTCGGTTCTTGTGTTTGCTAATAACGATCTTGGAGGGTGTATTCCCGCAAGTATTGGGAA
AATGGGGAAAACGTTGAATGAGTTGATATTGATGAATGATAACCTCACTGGGTGTTTGCCAATGGAGATTGGATTGTTGAACAAGTTAAC
CGTGTTTGATGTTAGCTTCAACAAGATTCAAGGCTCATTGCCATCAACTGTGAGCAAAATGAGGAGTGTGGAGGAACTGAATGTGGCTCA
CAACAAGCTTACTGGGGTTATACCAGCTAGCATTTGCCAACTTCCTAGGTTGCAAAACTTTACGTATTCCTTCAATTACTTCACCGGGGA
AGCTCCAGTTTGTGCTGCGACTAGATCTGGTGACGGCCAGGAGAACTGTATCGTTGGAAAGAAGAATCAAAGATCTGCTAAAGAATGCTC
TTCGGATGATGCAAAACCGTATGATTGTAGGAAATCCAAGTGTTATAGCCCTTTTGCTACATCTCCTTCGACAAAGCCAAAACCAAAACC
AAAGCCAAGAGGCCCACCACCACCTACTTGGAAGTCTTCGGGTTCGCATAACAAGCGATCTCCGCCGCCACCTAAATCAACTCCTCTTCC
TCCACCAGCACCTTACAAAAAGTCCCCAACCTATCAACATAGAAGTCCACCACCACCTACTCACAAAATTTCACCTGTAACTCATCATTC
ACCTCCTCCACCCTCACCTGTATATTACCACCCATCTCCATCGTCCCCACCACCACCAGTTTATTATTCTCCACCACCCCCCGTGTATCA
TGAGCCACCACCTACTTACAAGCCTAAATCACCACCACCACCACCAACACCGTCGTATGAACATCCAAAAACTCCATCACCACTACCACC
AACACCGTCGTACGAGCATCCAAAAACTCCACCATCACACGAACACCCAAAAACCCCATCACCACCAACACCATCATACGAGCATCCAAA
AACACCATCACACCCAACCCCACCTACCCCACCTTGTAACGAACCACCACCTCCACCTCCTAATTCACATTGGGAACCAAAACCATCACC
ACCATACACCTACTCATCACCACCACCTCCATCACCATCTCCTCCTCCTCCCACTTACTACTACTCATCACCACCGCCACCATCACCATC
ACCTCCCCCGCCCACTTACTCTTCTCCGCCACCACCACCACCATTTTACGAAAATATTCCTCTCCCACCGGTAATCGGAGTCTCCTACGC
ATCTCCACCACCACCAGTCATTCCATATTACTGAACAAGGGTTATCAATTAGCCTTTGATTTTCCATTATCAAAAAAAAAAGAATTCATT
TTTTTTTATGAATTATGTATACTTTGTTATTTATTTTTTGTAATATTTTTATTTTGAGTTTGATTATATTTACG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
X55687 entensin X55687extensin
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E746215
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None