This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U591986 in the current build, Tomato 200607 #2
Unigene SGN-U334149

Unigene Basic Information 
Unigene ID: SGN-U334149
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 334149
mRNA sequence: Length: 521 bp

>SGN-U334149 Tomato 200607 #1 (1 members)
GGGGAAACAAAAAAAAAATGGGTTCTAAAGCATTTCTGATTCTTGGCCTTTTTTTGGCCATATTTGTAATGATAAGTTCTGATGTTTTAG
CTAGGGAGTTGGCTGAGACTTCCACTACTACTTCTGAAGAGGATTCCAAGAAATCCAGTAACAAAAATGAAGTACATGAAGCCGAATATG
GCGGGTACCCCGGTGGTGGCGGTGGATACCCTGGTGGTGGTGGATACCCTGGCGGCCGTGGTGGTGGTAAATACTCCGGCGGTGGTGGAC
GTGGCGGTGGCGGTGGCCGCGGTGGACGTGGTGGTGGTGGCCGGAAGTGTTGTTCCTAGATACAAAGGTGAATGAATATAGTAATATATA
GTTATCACCTTGTACTAATTAGTGGCAAGATGTATTAGTAGTAATATTCTTGCTGCTTTTTGGAGCTTATTGTAAGAAAAAATTATTATC
ATGAAATAAAAGCCATCATGTAATGTTTGTTAATTATGCTATGGTATGACAATATTTTACTTTGGTGTTTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
X55688 glycine rich protein
X55690 glycine rich protein X55690
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E734311
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (3)  
Gene Family (3)  
Preceding Unigenes (0)None