Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
The current build is, Tomato 200607 #2
Unigene SGN-U334462

Unigene Basic Information 
Unigene ID: SGN-U334462
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 334462
mRNA sequence: Length: 796 bp

>SGN-U334462 Tomato 200607 #1 (1 members)
ACAGTTGAATAAAATCACTGTTGCATTGCCTTGCACATTATCCACATGACAGAGAAAAGGAACATCGAAATCCTTTCAAACATTGTCCAA
ACTTACTTATCATATTAGTAGTAACTGTAACATTCATTTCCTTAGATTACTCAGAACTCTCTGTCCGGGAACAGAATTGGAGCAACCTGA
GACCAGATGAACAAAGCTGCAGTTGCCCACCCAGTCACGATCCTGACCCAGACAGATGGCCACCCAACGTCCACTAATTTTCCACTCTCC
CCCACAGAGGTTGACCAACCCGTAAGAAGCATTGCCGAGTACATACTAGCGAGAGAAAAGATAAGGTGGAAGAAAGAATAGGAGTATGAG
ACTGGCTTAGATCTCTCTTTTTCTTCCTCCTCATCAACCTTGTCCAACGGTAGCAAGGGCTTCCCTGAGGTGATTGCTGCCACTAATTTT
GCTGAGTCACTGGATAAGGCTTTGGTGAGACCTGGACGATTTGATCGCAACATTGTTGTCCCAAATCCTGATGTTGAAGGGCGGAAGCAG
ATTTTGGAATCTCACATGTCAAAGATTCTGAAGGCGGATGATGTTGACCTTATGATCATTGCTCGGGGGACTCCTGGATTTTCTGGTGCA
GACCTTGCAAACTTGGTGAATATCGCTGCTGTGAAGGCTGCTATGGATGGTGCCAAAGCCGTAAGCTTGGCTGATCTAGAGCATGCGAAG
GACAAGATCATGATGGGAAGTGAGCGCAAATCAGCTTTTATATCCCAAGAGTCGAGAAAACTTACAGCATACCATG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ftsh FtsH proteaseprotease
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E372352
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None