Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U587663 in the current build, Tomato 200607 #2

Unigene SGN-U334512

Unigene Basic Information

Unigene ID:	SGN-U334512
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	334512
mRNA sequence:	Length: 513 bp

>SGN-U334512 Tomato 200607 #1 (1 members)
GATTCCCCGGGCAGGAGGAATTGGCACAATGGCTCCTTATCAGGGAATCTTGATTAATGGTCAATTACCTGGTCCTGATATCAACTTAGA
CACCAATGACAATCTCGTTATCAATATCCACAACAGCTTGGATGAACCTTTTCTACTTTCCTGGAACGGAGTACAAAACAAAAGAAACTC
ATTTGTACATGGAGTATATGGAACAACATGCCCAATACCGCCAGGGAGAAATAACACATTCAATCTACAAGTGAATGATCAAATAAGGAG
TTTCTATTACTTCCCATCTCTTGCATTCCACAAAGCTGCTGGTGGTTTTGGAGGGATTAGGATTCTCAGCAAGCCTATAATCCCCATCCC
TTTTCCGGACCCTGCAAACGACTACACCATCCTCATTGGAGATTGGTACAAAAAGAACCACACGGACTTGGAAGCAATTCTTATCAATGG
ACGTGGTCCTAATGGTGTTACATTCACAGTCGATCAAAGGAAAACCTATAGATTGAGGATATC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E301362
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101438	Multicopper oxidase type 3 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Multicopper oxidase type 2 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Cupredoxin Multicopper oxidase type 1 - Molecular Function: copper ion binding (GO:0005507)	162
2	118466	Multicopper oxidase type 1 - Molecular Function: copper ion binding (GO:0005507) Multicopper oxidase type 2 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Multicopper oxidase type 3 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Cupredoxin	111
5	128966	Multicopper oxidase type 1 - Molecular Function: copper ion binding (GO:0005507) Multicopper oxidase type 2 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Multicopper oxidase type 3 - Molecular Function: copper ion binding (GO:0005507) - Molecular Function: oxidoreductase activity (GO:0016491) Cupredoxin	105

Preceding Unigenes (1)

Unigene	Build
SGN-U213558	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer