Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580437 in the current build, Tomato 200607 #2
Unigene SGN-U335705

Unigene Basic Information 
Unigene ID: SGN-U335705
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 335705
mRNA sequence: Length: 404 bp

>SGN-U335705 Tomato 200607 #1 (1 members)
TTTTTTTTTTTTTTTTTTTTCCGAGAAATTGCAACACTTGCAAAACCCATTTGTAAAATGTAAAGAACAAACTGCAACAAAGACTTACAG
TCAATAAAGCATCTCATACAAACTCAAGTGCACTATCCAACCAAACAAAAAGAAAAACAGAAATCTGAAAAAACAACTACTATCATGTAT
TATTATTCCACAACAAACTGCACCCTTCAACTAACACACGAGTTTGTTACCTCTTCGCATAACAAGTAAATACGCGAATTATCCACTTAT
GTAGTGAGGTTGGGAGGAAGGTAGTCAGATTTAGTTCCAAGAACCCGGGCCTTGGTGTCGGGGAAAAATTCATGGCCTGGTAGCTCTGTG
ATATCCCCTTCGCTAGCCACTCCAATAGGGTAGCGGAGCAAGTG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
plda1 phospholipase PLDa1phospholipase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E696426
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None