This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U565412 in the current build, Tomato 200607 #2
Unigene SGN-U335800

Unigene Basic Information 
Unigene ID: SGN-U335800
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 335800
mRNA sequence: Length: 2377 bp

>SGN-U335800 Tomato 200607 #1 (1 members)
GAGGCAAAAAAAATAAAATGTCAAGTGGTGGTTGTAGTATAGTATGGTTTAGGAGGGATCTGAGGCTTGAAGATAATCCAGCACTGGCTG
CTGCAGTGAGAGCAGGATCAGTGATTGCTGTGTTTATATGGGCACCAGAAGAAGAAGGATACTATTGCCCTGGAAGAGTGTCAAGATGGT
GGATTAAGAAAAGTTTGGCTCATCTTGATTCATCTTTGAAGAAACTTGGCACTTCACTCATTACAAAGAGATCTAATGATAGTGTTTCTT
CTCTTCTTCAAGTTGTCAAATCTACCGGTGCAACTCGAGTTTTTTTCAATCATTTATATGATCCAATATCACTTGTAAGGGATAATTGCG
CAAAGGAAACCTTATCAGCTGAAGGTGTATCTGTGTGTTCTTTCAATGCTGATTTGCTATATGAACCATGGGAAGTTGTCGATGATGAAA
GCCGTCCATTCAGCACATTTTCTGATTTTTGGGAAAAATGTCTTACCATGCCTTATGATCCTGAAGCTCCACTTCTTCCGCCTAAAAGGA
TAATATCTGGTGATGCATCAAGATGCCCTTCAGACAACTTGGTGTTTGAGAGTGAATTAGAGAAAGGAAGCAATGCACTTCTTGCTCGAG
CGTGGTCTCCTGGTTGGAGCAATGCTGATAAGGCACTCACTACTTTCATTAATGGACCGTTGATTGAGTATTCCAAGAATCGTAGTAAAG
CTGATAGTGCAACAACCTCATTTCTGTCACCGTGTTTACATTTTGGTGAAGTCAGTGTTCGTAAGGTATTCCATCGTATTCGTACTAAAC
AAACACTCTGGGCTAATGAAGGAAACAAAGCAGGTGAAGAGAGTGTCAACTTGTTCCTCAAGTCTATCGGCCTTAGGGAGTTCTCGAGAT
ACATGAGCTTTTATCATCCTTACAGTCATGAAAGGCCATTGCTTGGTCAGTTGAAGTACTTCCCTTGGTTAGTAGACGAGGGTTATTTTA
AGGCGTGGAGGCAAGGTAGAACAGGTTATCCTTTAGTTGATGCAGGTATGAGAGAACTTTGGGCCACTGGCTGGTTACATGATCGTATTC
GAGTTGTTGTGTCTAGTTTCTCTGTTAAGGTTCTGCAGCCTCCTTGGACATGGGGAATGAAGTATTTCTGGGACACACTGTTAGATGCAG
ATCTCGAGAGTGATGCTCTTGGTTGGCAATTTATTACCGGTACCCTACCTGATGGTTGTGAGTTCCTCGGAATTGATAATCCACAGTTTG
AGGGATACAAGTTTGATCCAAATGGGGAATATGTTCGACGATGGCTTCCTGAACTTGCTAGGCTGCCCACAGAATGGATACACCACCCAT
GGGATGCACCAGAATCTGTACTTCAAGCTGCTGGAATTGAGCTTGGTTCCAATTATCCTTTTCCTATCGTTGAAATCGTTGCAGCAAAAG
AACGACTAGAAGAAGCGTTGTCACAAATGTGGCAGCTTGAAGCAGCTGCAAGATCTGCTATTGAGAATGGAATGGAGGAAGGACATGGAG
ACTCCACTGATGAGTTTGTCCCAATAGCTTTTCCTCAGGCTATGCAGATAGAAATGGAAGCTAATAATGTACCGGTCAGGAACAATAATC
CTACAATTACTGCTCTACGACGTTATGGAGATCAGATTGTTCCTAGCATGTCATCTTCCTTTTTTAGGAATGAAGACGAAGAAACCTCTG
TTGATATTAGAAATTCAGTTGTAGATAGTAGAGCAGAAGTTCCAATAATATCGATGTAATGCAAGAACTATGGAATACGTACACTTGACC
AAGCAGGAACTCCGAAGATCAAAATATCACATTTATATACAGATATGATGCCTCTACTTCTCTGTACCAGACATTAGTTGAGACGATACG
TAGTAGTTATGATTTTAGTTCCAGAGGATGTCGAAGCCTCATGGAACTTTCTTAACCTGTGTGTGATATGCACTTGCTACAGGTGTATCG
TTGTGGCCAGCATTTGGAGAGTTTGATTTCTCAGATGATCACTCGACTAATTGTTATCATCTCAGGAAGTCACTTTCTTTGTTGAAAGTT
TTGGAATCAAGAAGAAAGGGGACTTTCGAGATAATAACTATTAATCAAGTGACTATACGAGAAATCAACCGAGCATTTGGATTACGAATA
AGCACACTTAGCATGGGATCAATCTATATAGCTTGGTTATATCAGCTGTAAATTTGTGTATAGTATGTCCAGATTTTCTTATTTTTCTGC
ATCTCTTACCGGTTTGTACTGGTGTGTTTCCGTTGTATAGAATAGGTGTACTCTTTAAAGACAATGTGTCGAAAGGGATTGAAGTCTCGT
TGAGATATAATATAATTAAGTTATAAAAAATGCAATC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cry1b cryptochrome 1b
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E745768
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None