This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U566704 in the current build, Tomato 200607 #2
Unigene SGN-U336705

Unigene Basic Information 
Unigene ID: SGN-U336705
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 336705
mRNA sequence: Length: 3369 bp

>SGN-U336705 Tomato 200607 #1 (1 members)
ATGAAAATGATGGCAACTCTGTACTTCCCTATGGTTCTCTTGATTCCCTCGTTTCAAATCTTATCAGGATACCACATTTTCTTGGTTTCC
TCTCAATGCCTTGACGATCAAAAGTCATTGTTGCTGCAGTTTAAGGGAAGCCTCCAATATGATTCTACTTTGTCAAAGAAATTGGCAAAA
TGGAACGACATGACAAGTGAATGTTGCAATTGGAATGGGGTTACATGCAATCTCTTTGGTCATGTCATCGCTTTGGAACTGGATGATGAG
ACTATTTCTAGTGGAATTGAGAATTCTAGTGCACTTTTCAGTCTTCAATATCTTGAGAGCCTAAATTTGGCTGACAACATGTTCAATGTT
GGCATACCAGTTGGTATAGACAACCTCACAAACTTGAAGTACCTGAATTTATCCAATGCTGGTTTTGTCGGGCAAATTCCTATAACATTA
TCAAGATTAACAAGGCTAGTTACTCTTGATCTCTCAACTATTCTCCCTTTTTTTGATCAGCCACTTAAACTTGAGAATCCCAATTTGAGT
CATTTCATTGAGAACTCAACAGAGCTTAGAGAGCTTTACCTTGATGGGGTTGATCTTTCGTCTCAGAGGTCTGAGTGGTGTCAATCTTTA
TCTTTACATTTGCCTAACTTGACCGTTTTGAGCTTGCGTGATTGTCAAATTTCAGGCCCTTTGGATGAATCACTTACTAAGCTTCACTTT
CTCTCTTTTGTCCAACTTGACCAGAACAATCTCTCTAGCACAGTTCCTGAATATTTTGCCAATTTCTCGAACTTGACTACATTGACCCTG
GGCTCTTGTAATCTACAGGGAACATTTCCTGAAAGAATCTTTCAGGTATCAGTTTTAGAGAGTTTGGACTTGTCAATTAACAAGTTGCTT
CGTGGTAGTATTCCAATTTTTTTCCGAAATGGATCTCTGAGGAGGATATCACTAAGCTACACCAACTTTTCCGGTTCATTACCAGAGTCC
ATTTCGAACCATCAAAATCTATCCAGGTTAGAGCTTTCTAATTGCAATTTCTATGGATCAATACCTTCCACAATGGCAAACCTTAGAAAT
CTTGGTTATTTGGATTTCTCCTTCAACAATTTCACTGGTTCTATCCCATATTTTCGACTGTCCAAGAAACTCACCTACTTAGACCTTTCA
CGTAATGGTCTAACTGGTCTCTTGTCTAGAGCTCATTTTGAAGGACTCTCAGAGCTTGTCCACATTAATTTAGGGAACAATTTACTCAGC
GGGAGCCTTCCTGCATATATATTTGAGCTCCCCTCGTTGCAGCAGCTTTTTCTTTACAGAAATCAATTTGTTGGCCAAGTCGACGAATTT
CGCAATGCATCCTCCTCTCCGTTGGATACAGTTGACTTGACAAACAACCACCTGAATGGATCGATTCCGAAGTCCATGTTTGAAATTGAA
AGGCTTAAGGTGCTCTCACTTTCTTCCAACTTCTTTAGAGGGACAGTGCCCCTTGACCTCATTGGGAGGCTGAGCAACCTTTCAAGACTG
GAGCTTTCTTACAATAAGTTGACTGTTGATGCAAGTAGCAGCAATTCAACCTCTTTCACATTTCCCCAGTTGAACATATTGAAATTAGCG
TCTTGTCGGCTGCAAAAGTTCCCCGATCTCAAGAATCAGTCATGGATGATGCACTTAGACCTTTCAGACAACCAAATATTGGGGGCAATA
CCAAATTGGATCTGGGGAATTGGTGGTGGAGGTCTCACCCACCTGAATCTTTCATTCAATCAGCTGGAGTACGTGGAACAGCCTTACACT
GCTTCCAGCAATCTTGTAGTCCTTGATTTGCATTCCAACCGTTTAAAAGGTGACTTACTAATACCACCTTGCACTGCCATCTATGTGAAC
TACTCTAGCAATAATTTAAACAATTCCATCCCAACAGATATTGGAAAGTCTCTTGGTTTTGCCTCCTTTTTCTCGGTAGCAAACAATGGC
ATTACTGGAATAATTCCTGAATCCATATGCAACTGCAGCTACCTTCAAGTTCTTGATTTCTCTAACAATGCCTTGAGTGGAACAATACCA
CCATGTCTACTGGAATATAGTACAAAACTTGGAGTGCTGAATCTTGGGAACAATAAACTCAATGGTGTTATACCAGATTCATTTTCAATT
GGTTGTGCTCTACAAACATTAGACCTCAGTGCGAATAACTTACAAGGCAGGCTGCCAAAATCGATTGTGAATTGTAAGTTGTTGGAGGTC
CTGAATGTTGGAAATAACAGACTTGTTGATCATTTCCCATGCATGTTGAGGAACTCAAACAGTCTGAGGGTCCTAGTCTTGCGCTCCAAT
AAATTCTATGGAAATCTTATGTGTGATGTAACCAGAAATAGCTGGCAGAATCTCCAGATCATAGATATAGCTTCCAACAACTTCACTGGT
GTGTTGAATGCAGAATTCTTTTCAAATTGGAGAGGAATGATGGTTGCAGATGATTACGTGGAGACAGGACGCAATCATATCCAGTATGAG
TTCTTACAACTAAGTAAATTGTACTATCAGGACACAGTGACATTAACCATCAAAGGCATGGAGCTGGAGCTTGTGAAGATTCTCAGGGTC
TTCACATCTATTGATTTCTCTTCCAATAGATTTCAAGGAGCGATACCAGATGCTATCGGGAATCTCAGCTCACTTTATGTTCTGAATCTG
TCACACAATGCCCTTGAGGGACCAATCCCAAAATCGATTGGGAAGCTACAAATGCTTGAATCACTAGACCTGTCAACAAACCACCTGTCC
GGGGAGATCCCATCAGAGCTTGCAAGTCTCACATTCTTAGCAGCTTTGAACTTATCGTTCAACAAATTGTTTGGCAAAATTCCATCAACT
AATCAGTTTCAAACATTCTCAGCAGATTCCTTTGAAGGAAACAGTGGCCTATGCGGGCTCCCTCTCAACAACAGTTGTCAAAGCAATGGC
TCAGCCTCAGAGTCCCTGCCTCCACCAACTCCGCTACCAGACTCAGATGATGAATGGGAGTTCATTTTTGCAGCAGTTGGATACATAGTA
GGGGCAGCAAATACTATTTCAGTTGTGTGGTTTTACAAGCCAGTGAAGAAATGGTTTGATAAGCATATGGAGAAATGCTTGCTTTGGTTT
TCAAGAAAGTGATTATTAAACCCATAAATAATGAGTTTATTCTTGGAGTGTTTTGTTTTAAATAAACAACAGGATAAGGAAAATCAAGTT
AATAAGCTCGCAGAACATGATTGTTATTTCCTTTGATGAATGTATACAATTTTCAATATTGGTTCTTCAACCATAACCGCAGGCTAACTG
TCAGTTGTTGGAAGTCCTGAATTTTGGAAATGACATACA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ve1 verticillium wilt disease resistanceLRR
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E747170
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None