This unigene is from an out-of-date build, Tomato 200607 #1
The current build is, Tomato 200607 #2
Unigene SGN-U338493

Unigene Basic Information 
Unigene ID: SGN-U338493
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 338493
mRNA sequence: Length: 1246 bp

>SGN-U338493 Tomato 200607 #1 (1 members)
GCTGCTATTTTGGGTTCTCATCAACCATTTCCACAGCTTTCTCAGGGCTCATCACATAGTATCCATCAGTCAACTTCACTTCTTTTAGCT
CAACTTCAAAATACCTTGCAAATTTTTCCCAACTTTGAACAAAAAAATAATAATTAAGAATGGGTTCCAAGGCAATTTTGTTTCTTGGTC
TTTTTTTGGCTATTTTCTTAATGATAAGCTCTGAGGTTGCAGCTAGGGAGTTGGCAGCTGAGACTACCAATGCGGTGAAATTGGATAACG
AGAATGCAGTAAACGTCGATCATTATTATGGCAAGGGCTATGGCAAACGTAAGAAATGTTACAGTTGCTGCAAAAAATACAAATATGGAT
GCAAAAAATACTGCTGCTCTTATGAAGAATATGTTGCTGCCCAGACTCAAAACTAAATAATTAATTAGTGCTTAATTATGTGTATTTATT
ATTATTGTAAACTTTTGAAATTAAGTGACAAGATAATAATAATCTTGCTACTTAATTAAGACCCTTTGCTTGTAACAAGTATGAATAAAG
CCATTCATTTACGTACTATGAATGGTTGGTCATGATGTAATGTTTTGTTGTACCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGG
CAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACCGCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACAT
TACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCT
TCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCA
CGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCAC
TGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCG
TCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAATGTGTATATGTCAACAGTGAGAAACTGTTCGCATTTTCCG
TTTTGCTTCTTTCTTTCTATTCAATGTATGTTGTTGGATTCCAGTTGAATTTATTATGAGAACTAATAATAATAGT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
X77373 cell wall protein X77373
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E746931
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None