This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581590 in the current build, Tomato 200607 #2
Unigene SGN-U338647

Unigene Basic Information 
Unigene ID: SGN-U338647
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 338647
mRNA sequence: Length: 384 bp

>SGN-U338647 Tomato 200607 #1 (1 members)
GAGCAGATTCCTCTCACTGGTCCACAGTCCATCATTGGAAGAGCTGTTGTTGTTCATGCTGATCCTGATGATCTTGGAAAGGGAGGACAT
GAGCTCAGTAAAAGCACCGGAAATGCTGGCGGAAGGATTGCTTGTGGTATTATTGGCCTCCAGGGTTAACTGCTCCGGTGAGGTGAAGAT
TCAGCAACTAGCGGTGGTGTCTGTCTTAGAATAAAGTTATATTGGAGCTGCTGAGCCTTGTTTTCTATGTATTTATCATTTGACGCCTTT
TGAATTGGGGTTGAACCATTCATAATACATGACTGTAGTGCTGCTTTTCAGTGGATGTTGTACTAGTTTTTGCCGATCATTAACCATAAA
AAAACATGGGCTGTGTTAGCTTTG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sod superoxide dismutase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E552654
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)