Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577544 in the current build, Tomato 200607 #2

Unigene SGN-U338923

Unigene Basic Information

Unigene ID:	SGN-U338923
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	338923
mRNA sequence:	Length: 756 bp

>SGN-U338923 Tomato 200607 #1 (1 members)
GTTTTGGTGTTGTTCTAAGTTCAAATAGTGTTACGTTTTTGTTAACTTTTGGGATGTTTATCTGTTGACTGAATGAATTAGGACCGGGGC
ACTTGCTCCTTTCCAATATATACTGACCTGTATTGTGGTGCCTTTGACTATCAATAATTCTATATTGGCGTTAAAAAAAAAAAAAAAAAA
AACTCGACCGATTGGAAAGGTTCCTGTGCTTGAAACACCTGATGGACCTGTTTTTGAGAGCAATGCTATCGCACGCTATGTTACTAAATT
AAAGCCCAACAATCCTCTTTTTGGATCTTCATTGATTGAATATTCTCAAATTGAACAATGGAATGATTTTTCTGCCACTGAAGTTGATGC
AAACATTGGACGATGGCTGTACCCACGCCTTGGCTTTCGTGTGTACATCCCTGCGGCCGAGGAAGCTGCGGTAGCTGCATTGAAGAGAGC
GCTTGGTGCTTTGAACACCCATCTTGCATCTAACACATACTTGGTTGGGCATTCAATCACATTGGCTGACATCATTATGGTCTGCAACTT
GAGCATTGGTTTTAGGATGATAATGACCAAGAGCTTTACCAAGGAATTCCCACATGTAGAGAGATACTTCTGGACTGTGGTTAATCAGCC
AAACTTCTGCAAGATATTGCGTGAAGTGAAGCAAGCTGAATCTATCCCAGCTGTGCAATCCAAGAAGCCTGCACAACCTGAAAAACCCAA
GGCTAAGGAGGAGCTAAAGAAGGGAGTTAAGAAGGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E261803
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101396	Thioredoxin-like fold Glutathione S-transferase C-terminal-like	299
2	119155	Elongation factor 1 gamma chain - Molecular Function: translation elongation factor activity (GO:0003746) - Cellular Component: eukaryotic translation elongation factor 1 complex (GO:0005853) - Biological Process: translational elongation (GO:0006414) Thioredoxin fold Glutathione S-transferase C-terminal Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	19
5	129505	Elongation factor 1 gamma chain - Molecular Function: translation elongation factor activity (GO:0003746) - Cellular Component: eukaryotic translation elongation factor 1 complex (GO:0005853) - Biological Process: translational elongation (GO:0006414) Thioredoxin fold Glutathione S-transferase C-terminal Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	19

Preceding Unigenes (1)

Unigene	Build
SGN-U212996	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer