This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U590750 in the current build, Tomato 200607 #2
Unigene SGN-U338959

Unigene Basic Information 
Unigene ID: SGN-U338959
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 338959
mRNA sequence: Length: 453 bp

>SGN-U338959 Tomato 200607 #1 (1 members)
ACATTTAAAACTCCAGTTCATCTCTCTTGTTAGTCATGAGTTTTACAAACTGGAACAAATAGGAAGATTGGAAAAGGACATTTGCACAAC
AAAAAATTAGGAACAACGAAAACCGCTTTCTAAAACTGAAGGCCGTGTTCTCGTGCAGCATCTGCAAGAGCTTCTATCCCAATGTTACAC
AAGCTAGCATGGTTGCACCTTTCACTGGTCTCAAATCTTCAGCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTCCATTG
CTAGCAATGGTGGAAGAGTTAGCTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTTGT
CTGACGAGCAATTGCTTAGTGAAATTGAGTACCTTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTTGAGACTGAGCACGGATTTGTCT
ACC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ss5 Tomato RuBP carboxylase small subunit
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E285381
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)