This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578689 in the current build, Tomato 200607 #2
Unigene SGN-U338973

Unigene Basic Information 
Unigene ID: SGN-U338973
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 338973
mRNA sequence: Length: 1078 bp

>SGN-U338973 Tomato 200607 #1 (1 members)
CAGCATTCATAGTGAGTAGAAATGGCTTTGGGTGGAGGTGGACCGCAAAGGGGGACTGCAGCAGCAGCAGCTGCTAACCTACGTCGAAGG
AAGACAGGAGGAGCAGGTGGAGCTGCAGGAGGAGCAGGTGGTACCATGCTCCAATTCTACACTGATGATTCCCCCGGACTCAAGATATCC
CCCAATGTTGTGCTTGTAATGAGTATTGGCTTTATAGGTTTTGTCGCAATCCTTCACGTCATGGGTAAGCTTTAGTTTGTCCGCAGAGAG
GGCTAGAGCCATCTCATTGCTGACTTTTGAAATTTTTGTTGGGCAAACAGCTTTCTAGTGAAAGGAAAACTGACATTGTAGATTTGTTTA
TATGGCTTCCTCTGTCATTTCTTCAGCAGCTGTTGCCACACGCAGCAATGTTACACAAGCTAGCATGGTTGCACCTTTCACTGGTCTCAA
ATCTTCAGCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTCCATTGCTAGCAATGGTGGAAGAGTTAGCTGCATGCAGGT
GTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTTGTCTGACGAGCAATTGCTTAGTGAAATTGAGTACCT
TTTGAAAAATGGATGGGTTCCTTGCTTGGAATTTGAGACTGAGCACGGATTTGTCTACCGTGAGAACAACAAGTCACCAGGATACTATGA
TGGAAGGTACTGGACCATGTGGAAGTTGCCTATGTTTGGGTGCACTGATGCAACCCAAGTGTTGGCTGAGGTTCAAGAGGCTAAAAAGGC
ATACCCACAAGCATGGGTCAGAATCATTGGATTCGACAATGTGCGTCAAGTGCAGTGTATCAGTTTCATTGCCTACAAGCCAGAAGGCTA
CTAAGTTTCATATTAGGAACAAAATTGTCTTTAGGGACACTTTGTTTTTAAATGCTACTTAGGTCTTTTTTCTTTTTTGTCTTAATTCCA
ACAAACTCTTTGTGTCTTGTACTATTCGGTTTATGTTTTGGATTTATGAGTACCTAATTATATGATAATGATTTGGTGCTTTGTTTGT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ss5 Tomato RuBP carboxylase small subunit
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E746844
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None