Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U591878 in the current build, Tomato 200607 #2

Unigene SGN-U338975

Unigene Basic Information

Unigene ID:	SGN-U338975
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	338975
mRNA sequence:	Length: 344 bp

>SGN-U338975 Tomato 200607 #1 (1 members)
GCTCCACCGACCCATTCAACTCCTTTACCATGACTCGCGGAAATCAGAGGGAAAAGGATCGGGAAAGAGCTGCAGCTCGTGCTGGTAAAA
GCAAGAAGGGAGCTGATGATGGTTTGACTCCTGAGCAGCGCCGTGAAAGGGATGCGAAAGCTCTGCAAGAGAAGGCTGCAAAGAAAGCAC
CAAAAGAGGCTGCCGGAGGTAGCAATGCTGGAACTAAGGATCCCAAAAAATAAAAAGCTAGGGGTGGGGTCCTTCATGGCAGCCAGAAAT
TGGCCATTCCCCTTGGTTGGCCATGTTATTCACTGTTTAAATCTTGTGATGCACTACAACTTAATACGTCTGAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E306587
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 1 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101375	Chaperonin Cpn10 - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein folding (GO:0006457) GroES-like	508
2	120758	Four F5 protein	8
5	132662	Four F5 protein	5

Preceding Unigenes (1)

Unigene	Build
SGN-U233209	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer