This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U573988 in the current build, Tomato 200607 #2
Unigene SGN-U341561

Unigene Basic Information 
Unigene ID: SGN-U341561
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 341561
mRNA sequence: Length: 1190 bp

>SGN-U341561 Tomato 200607 #1 (1 members)
ACGAGAAACAATTGATGCTTAGTTCTCGTCTGATAAACAATTTTTTTCCTCGGTTTCTCTCACAGTGTTGCAATGGGAAAAGTAGGTGAG
GAATTGACAGAGCAAGAAACTGCCATATATGATCGCCAAATTAGGGTTTGGGGTGTTGATGCTCAGCGAAGGTTGAGCAAATCTCATATA
TTTGTCAGTGGACTGAAAGGGACTGTTATTGAGTTCTGCAAGAACATTGTCTTAGCCGGAGTCGGTAGTTTGACGCTAAATGATGATCGA
CTTGTAACAGAAGAGCTACTGTCTGCTAATTTTTTAGTTCCTTCTGATGAAAATGTGACCAGTGGGAAATCACTTGCTGAGCTTTGTTGT
GAATCACTGAAAGATTTCAACCCCATGGTTACTGTTTCTGTTGAAAAAGGTGTTCTGGCCAACTTCCATGTTGAATTCTTTCAGAAGTTT
GATGCTGTTGTCATCAGTTGCTGCTCGCTGCTGACAAAAAAATCGGTTAATGCAAAGTGTCGCAAGTTGCCAAGACGTGTCGCATTTTAT
TCTGTAGAATGCCGAGATTCCTGCGGTGAGATATTTGTTGACTTGCAGAGCTACTCCAAGAAAAAGAATGAAGAAACAATTGAATGCCAA
CTACAGTATCCGAGTTTTGAGGAAGCCATTGCAGTCCCGTGGAGATCTCTACCCAAGAGAATGTCAAAGCTATATTTTGCCATGAGAGTT
CTAGAGAGGTTTGAAGTGCTTGAAAAGCAAAATCCTCAAGATACTTCCGGAGATGACCTTCCAAATGTTCTGAAATTGAGGAAGGAACTT
TGTGAGGCACAGTGCATAAATGAATCTCAGATCCCGGTTCCTCTCCTGCAAAGGTTGTTAGCAGCTAGAGTTGAATTTCCTTCAGTTTGT
GCCATTATAGGAGGAGTCCTTGGACAGGTTATAAAAGCAATATCTGGAAAAGGTGATCCTCTTAAAAACTTTTTCTTGTTTGATGCCATG
GATGGCAAAGGAATAATAGAGGACATATCAGGATAATCAGTGGCTTGTGGTAAAAATTCTTTATATTAATGCTAACCTTATTTGTGGATT
TGTCTCCTATTGGATGAACTTTCACTATGTAATTACTCCACTAACCATATGTTATCTCACTGATATGACTTAGTTGAGCTTTTTGAGTGT
TAATCTGTTGCACTTTGGTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AJ011418 ubiquitin activating enzymeubiquitin activating enzyme
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E744806
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None