This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U597870 in the current build, Tomato 200607 #2
Unigene SGN-U341639

Unigene Basic Information 
Unigene ID: SGN-U341639
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 341639
mRNA sequence: Length: 2403 bp

>SGN-U341639 Tomato 200607 #1 (1 members)
ATGTCGATCTCAGCTTCTTTTTTAAGATTTAGCCTCACTGCTCACTATCAACCTTCTCCTTCTTCTTCTCCACCAAATCAACCTTTCAAA
TTCCTTAAAAGCAACAGAGAACATGTTGAATTCAATCGAATTTTGCAATGTCATGCTGTTTCTAGACGTCGTACAAAAGATTACAAAGAG
GTGCAAAGTGGTTCGTTGCCGGTTATCAAGTGGGACGACATAGCAGAGGAAGTGGACGAGGAAACACACACACTTGAGGTGTACGATCCA
TCCTCCAACGAGGACCATATCGATGCTATTCGATCGATGCTAGGATCAATGGGAGACGGAGAAATAAGCGTCTCGGCCTATGACACAGCA
TGGGTTGCCATGGTGAAAGATGTGAAGGGGACTGAAACTCCTCAGTTCCCTTCAAGCCTTGAGTGGATTGCGAACAATCAGTTGGCTGAT
GGTTCATGGGGTGACAACTCCATTTTCTTGGTTTATGATCGTGTCATCAACACATTGGCTTGTGTTATTGCCTTGAAGTCATGGAACTTG
CATCCTGACAAGATTCTACTTGGAATGTCGTTTATGAGAGAGAATTTGAGCAGGATTGGTGATGAGAATGCAGAGCACATGCCTATAGGC
TTCGAAGTGGCATTTCCTTCACTCATTGAGATTGCTAAAAAGTTAGGCTTAGATTTTCCTTATGATTCTCCCGTCTTGCAAGACATCTAT
GCCAGTAGACAACTAAAGCTTACAAGGATACCAAAGGACATCATGCACAAAGTCCCCACAACTTTACTCCACAGTTTGGAAGGAATGACA
GATTTGGACTGGCAAAAGTTGCTTCAATTTCAGTGCACTGATGGCTCTTTTCTCTTCTCTCCATCTTCCACCGCATATGCACTTATGCAA
ACTCAAGATCATAATTGTCTCAATTATCTCAAAAATGCTGTCCACAAATTCAACGGCGGAGTTCCAAATGTGTATCCAGTGGACCTATTT
GAACATATTTGGACCGTTGATCGGTTGCAAAGGCTTGGAATTTCTCGGTATTTTGAGCTAAAAATAAAAAAGTGCATTGATTACTTTAGC
AAATATTGGACAAATAAAGGAATCTGCTGGGCTAGAAATTCCCCAGTTCAAGACATTGATGACACGGCTATGGCTTTTAGACTTTTGCGC
TTGCATGGCTACGCTGTTTCTGCTGACGTATTCAAACATTTTGAGAGCAAAGGCGAATTTTTCTGCTTCGTGGGGCAATCAAATCAAGCA
GTGACAGGAATGTATAATCTTTATAGGGCATCTCATGTAATGTTCTCAGGAGAGAAAATACTTGAAAATGCAAAAATATCCACTTCTAAT
TATCTAAGAGAAAAACGAGCTCAAAATCAACTGCTAGACAAGTGGATCATTACTAAAGATTTACCTGGAGAGGTGGGATATGCATTAGAT
GTGCCATGGTATGCTAGCCTACCCCGCCTAGAAACAAGGTTCTTTTTAGAACATTATGGTGGTGAAGATGACGTGTGGATTGGCAAAACA
TTGTACAGGATGCCATTGGTTAACAATAGCCTATACCTAGAGCTAGCGAAATCGGACTATAACAATTGCCAAGCTTTGCACCAGTTCGAG
TGGAGAAGAATTCGCAAGTGGTACTACGAATGCGGGCTAAGAGAGTTTGGATTAAGTGAAAAAAGGTTGTTGGTTACGTACTATTTAGGC
AGTGCTAGTATATTTGAGGCACAAAGGTCGACCGAGCGAATGGCTTGGGTCAAAACCGCAGCTCTTATGGACTGTGTGAGGTCTTGTTTT
GGCTCCCCACAAGTATCTGCAGCTGCATTTCTTTGCGAATTCGCACACTACTCTAGCACCGCTCTGAATTCGAGGTACAACACAGAAGAT
AGGCTCGTTGGGGTCATTCTTGGAACCCTAAATCATCTCTCACTGAGTGCCTTATTAACACATGGCAGAGACATCCATCACTACTTGCGT
CATGCTTGGGAAAATTGGCTACTGACGGTAGGAGAAGGAGAAGGAGAAGGAGAAGGAGGTGCTGAACTCATAATTCGCACCTTAAATTTG
TGCAGTGTTCATTGGATATCGGAGGAGATATTGTTGTCCCATCCAACTTACCAAAAGCTATTGGAAATTACCAATAGAGTTTCTCACCGA
CTCCGTCTCTACAAGGGACACAGTGAAAAGCAGGTAGGAATGTTGACTTTTAGTGAAGAAATAGAAGGTGACATGCAACAGCTAGCAGAG
CTCGTGCTATCTCATTCAGATGCTTCCGAATTGGATGCCAATATCAAAGACACTTTTCTCACTGTTGCCAAAAGTTTTTACTACTCAGCT
TATTGTGATGATCGAACAATTAACTTTCACATAGCCAAAGTGCTATTTGAAAGAGTAGTTTAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cps1 copalyl diphosphate synthaseGA biosynthesis
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E747709
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None