Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U583132 in the current build, Tomato 200607 #2

Unigene SGN-U343277

Unigene Basic Information

Unigene ID:	SGN-U343277
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	343277
mRNA sequence:	Length: 549 bp

>SGN-U343277 Tomato 200607 #1 (1 members)
TAGGCAATCATTCATCTTTTTGCTGAGTCAATTGCTGGAGCTGGAACAATCAGAGGTTTTGGACAAGAAAAGAGATTTATGAAGAGGAAC
CTTTATCTCTTGGATTGCTTTGCTCGACCATTCTTCTGCAGTCTTGCAGCAATCGAATGGCTTTGCCTACGCATGGAGTTGCTCTCTACA
TTTGTCTTTGCTTTCTGCATGGTTTTACTTGTGAGCTTTCCTCATGGGAGCATAGATCCTAGTATGGCAGGTCTTGCTGTGACATATGGC
CTAAACTTGAATGCACGCCTGTCACGATGGATACTTAGTTTCTGCAAGCTTGAAAACAAGATTATTTCAATAGAAAGGATTCATCAATAT
TGTCATATTCCTAGTGAGGCCCCACAAATTATTGAACCTCGTCCCACATCGTCATGGCCAGAAGAAGGAACCATTGAACTGATTGATTTA
AAGGTTCGTTATAAGGAGAGTCTTCCAGTTGTGCTTCATGGTGTATCCTGCAAAATTCCTGGAGGAAAGAAAATTGGAATTGTGGGGCGC
ACAAGTAGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E324965
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101386	ABC transporter related - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATPase activity (GO:0016887)	388
2	118590	ABC transporter transmembrane region type 1 - Molecular Function: ATP binding (GO:0005524) - Biological Process: transport (GO:0006810) - Cellular Component: integral to membrane (GO:0016021) - Molecular Function: ATPase activity coupled to transmembrane movement of substances (GO:0042626) ABC transporter related - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATPase activity (GO:0016887)	47
5	129077	ABC transporter transmembrane region type 1 - Molecular Function: ATP binding (GO:0005524) - Biological Process: transport (GO:0006810) - Cellular Component: integral to membrane (GO:0016021) - Molecular Function: ATPase activity coupled to transmembrane movement of substances (GO:0042626) ABC transporter related - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATPase activity (GO:0016887)	46

Preceding Unigenes (1)

Unigene	Build
SGN-U238015	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer