This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U583560 in the current build, Tomato 200607 #2
Unigene SGN-U344111

Unigene Basic Information 
Unigene ID: SGN-U344111
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 344111
mRNA sequence: Length: 1066 bp

>SGN-U344111 Tomato 200607 #1 (1 members)
CACGAGGCAGCACGTAAATTAAGAGAGAACCAAAGCACTACCAGTGTACAGACAGAAGATCTTGTAGAAGATCCTGCTCAGGAGTCGGCA
GATTATCATCGTAACCTTGGTCTTCAGATGGTTTCTGGTTTAAGCAACGAGCTTGAGAATGTAAGAAAAGCTTCACTTATTGACGGCGAG
AACTTAAGTGCAGCTGTCATGAAGCTTAATCACTCACTCATGAAAACTAAAGAGTTTCTGGACACTGATATGAGAAGTTTGGAGGATGAA
AGTAAGTTCCGTGATACACTCACAAATTTTATCCAACATGCGGAACAGGACATTACTTGCATACTAGAAGAAGAGAAAAAGATAATGTCT
TTGGTTAAGAGCACAGGAGATTACTTCCATGGAAATTCAGGGAAGGATGAAGGCTTGCGTCTCTTTTCAGTCGTTAGTGATTTCTTGATT
ATGTTGGACAAGGCATGTACAGTGGTGAGAAACTCAACGAAGTTACCAGTTAAGATTCCTAAAAAAGGGACATTAACATCTCCTTCCCAA
GAATCCTGTCCTGAGTCTTTGCAAGACATACGTAAACAACTATTTCCTGCAATCCAGGAGCGACAGATGCACTATTCTAGTTCAGACGAC
GAGAGCTCAAGCCCGTAGCTGTCTATTTAGGTGTCAGAGTACTTTGGAGCTAATATGGCTTGGATAATAGTCCACAGAAGTATGTATTTA
ACGACTATATGAGGCCTAAGGTGTGCCTCCTACACCCAGTTAGCAAACACATGCTCTACGAGATAGAGTGAATAGACATTTTGCTTCAAT
GATCTCTTCGAGTCCTAGCACTAGCGGTAGGAAGAATGGCTATAGTATAGATGCCATAGTAGTTATTGCATGGTCTACTACAACGATCCA
CAGAGTTAAACCACAGCCTCTCACTGTCTGTAGTCACCTTTATCTATAACAATCCAAATATCGAGATGGTAATGGTACTGAAATCTCCTA
AATATTTGTTAAATTATATTTAGTATGTATTGGAAGTTAGACCAGATTCGTATAGTTTCAGCTTCTTTTTCTCGTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY150043 formin I2I isoform
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E746741
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None