This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U603209 in the current build, Tomato 200607 #2
Unigene SGN-U344813

Unigene Basic Information 
Unigene ID: SGN-U344813
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 344813
mRNA sequence: Length: 1404 bp

>SGN-U344813 Tomato 200607 #1 (1 members)
ATGGCCATTTTCTTGATAATTTTTGTTGTGTTTTTTGGATTTTGCATTTTGAGTACTCCTCTATTTAGATGGATTGACATTGTGTACAAC
AAGAAAAATTTGCCTCCTGGAACTATGGGTTGGCCAATTTTTGGTGAGACTAGGGAATTTCTAAATCAAGGTCCAAATTTCATGAAAAAT
CAAAGAGCAAGGTATGGGAATTTCTTCAAATCCCACATACTTGGTTGCCCTACTGTTGTTTCAATGGATGCAGGGTTGAATGTATATATT
CTGAATAATGAAGCAAAGGGACTTATCCCAGGCTACCCACAGTCCATGTTAGACATTTTAGGGAAATGCAATATTGCTGCTGTGCATGGT
GCTACTCACAAGTACATTAGAGGAGCACTTTTATCTCTAATAAATCCCACAATGATCAAAGACCATATTTTGCCCAAAATTGATAAATTC
ATGAGATCACATTTGAGTGGTTGGGATAATTGCAATGTCATTGATATTCAACAAATGACCAAAGAGATGGCATTTTTCTCATCATTGGAC
CAAATTGGTGGGTTTGCAACAAGCTCATCAATAGCTCAAGAATTCAGGGCTGGATTCTTGAATATTGCACTTGGAACTATTTCATTGCCT
ATCAACTTTCCCACCACAAACTATTATCGCGGATTACAGGGGCGGAAAACCATTGTCAAACTATTGAGGAAAATAATAGAAGATAGAAGA
GGTAGCAAGAAAATTCAACAAGACATGCTTGGTTTGATGATGAATGAAGAAGCAAAAAATAGATACACATTAAGTGATGAAGAGCTAATT
GATCAAATTATAACAATAATGTATTCTGGATTTGAAACTGTCTCCACTACTTCTATGATGGCTGTCAAGTATCTTCATGATCATCCAAAA
GCACTTGAAGAAATTAGAAAAGAACATTTTGCAATCAGAGAAAAGAAGAGTCTGGAGGATCCAATTGATTACAATGATTTTAAGGCTATG
AGATTTACAAGGGCTGTGATATATGAGACATTAAGGTTGGCAACAATTGTAAATGGTGTTCTTAGGAAAACCACACAAGATATGGAATTA
AATGGATACATGATTCCCAAAGGATGGAGGATATATGTGTACACAAGAGAGCTTAACTATGATCCATTGATTTATCCTGACCCGTATACC
TTTAACCCATGGAGATGGCTGGAAAATAACTTGGACCACCAAAGCTCTTTCTTGATGTTTGGAGGAGGTACAAGGCTTTGTCCTGGAAAG
GAACTAGGTGTGGCTGAAATTTCAACATTTCTTCATTACTTCGTTACAAGATACAGGTGGGAAGAGGTTGGAGGAAATAAGCTGATGAAA
TTTCCTAGAGTTGAAGCACTAAATGGCCTATGGATTAAGGTTTCAGCTTACTAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AB190445 cytochrome P450 AB190445cytochrome P450
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E747690
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None