This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U565158 in the current build, Tomato 200607 #2
Unigene SGN-U345429

Unigene Basic Information 
Unigene ID: SGN-U345429
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 345429
mRNA sequence: Length: 697 bp

>SGN-U345429 Tomato 200607 #1 (1 members)
CATTAAAGGATCCCCTTACCCCAGGGGTTACTACAGATGCAGCAGTTCAAAGGGTTGTTCAGCTAAAAAACAAGTAGAAAGGTGTAGTAA
AGATGCATCTTTGTTCATCATCACATATACATCCAGCCATAATCATCCAGGTCCAAATTTGCCTAAAGACTCTGTTAAACAAGAGCCAGT
AGTGGATCAACATGTGTCCCTCGAAGACAACAACGATGAAGATGATGATGATGATGATGATAATGATACACAAAGCTGCAAAACCCCATT
GAATAGTACCACTACTAGTACCAGTATTCCCCAAGGCATACTTGAAGAGAATCTGTTCACTGATAATTTCTTGGGAACAATTTCATATGA
TGATTTTCTGCCCCTTTCTTACCCTCAACTAATGAAATTTCCAAAATCCGAATTGTCAGAAGAGAATGACTTTTATGATGAATTAGGAGA
ATTGGAGCTACCTCCATCTTCTTCTACATCCTTCGCGGGCATTTTTGAGGAGGCAATCCTTGTANATCCCTCCTCTTAGTAAAATGCAGG
TATTAGATAGGTTAGTAGGGATTGATTTTTCACGGNCAGTCACTCAACTAATAGTTATTGTCTTANAAAGTTACTTTTATGAAGATAATA
ACCCCTATTGGATTTGGAATGGATCATCCTGGAGAAAAATCCAACCTGGCAAAAAAANAANANANAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlWRKY37 WRKY transcription factor 37transcription factor
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E746735
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None