This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U602266 in the current build, Tomato 200607 #2
Unigene SGN-U345689

Unigene Basic Information 
Unigene ID: SGN-U345689
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 345689
mRNA sequence: Length: 538 bp

>SGN-U345689 Tomato 200607 #1 (1 members)
AGAATTTAACTGTACTAATGCAATATTTTACCCAATTGATCCATGTAGCTCCAAATTCCATCGTCTGCATCATGAGAATCGAATAATTCC
AATTCAGGTGATCATATGCCTTCTGTTTATCTAGCTTACGTAAAATACCAGGCTACTAACTTCTTTACCTGGACTCCAGCCACACACTCA
TTTTCTATCAGCTGTGCATCCATGATTTATCTGCCTTTGATAAATGTCGTCTGCTATTTGTCCACTAATCAGTGTATGACTTTTTTCAAT
TTTTCTGCCAGTAGCTTGACAATGAGCTTGTAAACCCCCTCCTATCATATTCTAGGTCTGAAGGCTTGAACCCCATAGTTCCCATCTTCT
TAGGAATTAGAGCCACAAAGGTGGTGTTTAGGCTCCTTCAAAGAATTCCTGCGTCGTGTAAGTTTTGCACCGTTGCAACCGACTCTAGAC
TGATAAGTCCCTATCAATGACTAAAGGATGCCAGGGAGAACCCATCTGGCCCTGGTGTTTTGTCACCTGCACATACTTTTATATTCTC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E366748
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (1)  
Preceding Unigenes (1)