This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U586173 in the current build, Tomato 200607 #2
Unigene SGN-U346392

Unigene Basic Information 
Unigene ID: SGN-U346392
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 346392
mRNA sequence: Length: 2370 bp

>SGN-U346392 Tomato 200607 #1 (1 members)
ACTAAGTTTTGAGCAAAGATTGAATTTTTATCATATTTTGAGATTTGGAGTGAAGAGTTGAAGTGAAGTATTTGTTGGGGGTTGTTTGGT
TTTGTCCATTTTGTGGGATCTGTGGAAACTGACTAGTTGGAAATGGAGAGCAATTACAAGACAATTGTGTGGTTTAGGAGGGATTTGAGG
ATTGAGGATAATCCAGCTTTAGCTGCTGCTGCTAGAAATGGAAGTGTTTTACCGGTGTTTATTTGGTGTCCGAAGGAAGAAGGGCAATTT
TATCCCGGTAGAGTTTCAAGATGGTGGCTGAAGCAATCTCTGATTCACTTGAAACAGTCTTTGAAATCTCTTGGGGCTGAACTTGTGTTG
ATGAAAGCTCAGAGTACACTTTCTGCTCTCACGGAGTGTGTCGATGCTGTTGGAGCAACAAAAGTTGTGTATAATCATCTATATGATCCT
GTTTCACTTGTTCGTGACCACAATATCAAGCAAAAGTTGGGGGATCTTGGCATATCTGTTCAGAGCTACAACGGGGACTTACTGAATGAA
CCATGGGAAGTTTACGATGATGATGGCAAAGTTTTTACAACTTTTGATGCATACTGGGAGAAGTCATTAAGTATACAGAACGAACCTGTT
TCACAACTTCCTCCTTGGAGATTAACTCAAGCTGCAGGATCAGTTAAAATGTGTTCAGTTGAGGAGTTGGGACTGGAAAACGAGTCAGAA
AAATCTAGTAATGCATTACTAGGGAAAGGATGGGCACCAGGTTGGAGCAATGCAGACAAGGCCTTAACCGAATTTGTAGAGAGCAATCTA
CTCGCGTACTCAAAGGATAGGTTGAGAGTCGGGGGAAATTCTACATCCCTTTTGTCTCCTTATCTCCACTTTGGAGAAGTAAGTGTGAGG
AAAGTTTTCAATAGTGTACGCTTGAAGCAGATACTTTGGACCAAAGAAGGGAACTCTGTTGGAAAAGACAGTGCTACTATTTACCTTAGA
GCTATTGGACTGCGAGAGTATTCTCGTTATATCTGTTTTAATTTCCCATTTACTCATGAAAGGTCGTTACTGAACAACCTGAGGTTTTTC
CCTTGGAATGCTGATCAAGCCCATTTTAAGGCTTGGCGACAGGGACGGACTGGTTATCCATTAGTCGATGCAGGAATGAGGGAGCTTTGG
GCAACGGGATGGGTTCATAATAAAATAAGAGTGATTGTGTCAAGTTTCTTTGTCAAGTTTTTACTTCTGCCATGGCAATGGGGGATGAAA
TACTTCTGGGACACACTCTTGGACGCGGATTTAGAAAGTGACATAATTGGTTGGCAATACATCTCTGGTAGCTTGCCCGATGGTCATGAA
CTTGAGCGCCTCGATAACCCAGAGGTTCAAGGATTCAATTATGATCCGGAGGGCGAATATGTGAGACATTGGCTACCTGAGCTAGCAAGA
ATGCCGGCTGAGTGGATCCATCATCCTTGGGATGCACCACTTAATGTGCTCAAAGCTGCAGGGGTGGAACTCGGAATGAATTATCCGAAC
CCCATAATTGATGTAGATGTTGCGAGGGATCGTTTAATGCAAGCTATAATTATCATGAGAGAAAAAGAAGCAGCTGTGAATACTTCACAT
GCAAATGGAACTGTTGAAGTTGTGTTTGATAACTCGGAAAATGTTGGAGATTCAGCCAGTATTCCAAAGGACGACGTTGTAAAGGGAAAG
GAGCCTTGCCCGAGCAGTTCATCTTATGATCAAAGGGTGCCATCAATGCAAAATGTAGGCACTTATAGAAAGAGACCAAAGCCCGAAGAG
GAAACAAAGAAGCTCAATGATAACAAGCTTAGCTACAAGAACGAAAGGATCAAAATGTCAAACGTGGACGGTGACTTGTGCTCTACTGCA
GAATCCTCTTCTATGAAAAAACAGATGACCGTCAGCAGAAACTCATTCTCTGTACCTCGAACAATTACCATGTCTCACGACAGAAAATCC
TTTGATGACGAAGCATCATCACATGTGAAGCTACAAAAGGAAGAAGAGATTGACACATAAATCAACTCGTGCAAAAATGAAGCTACAATG
CGATGATTCCCTCACCATCTCCAAACATCTGATAGTTGAATCAACATATGCAGTGGAATGACGATATCCTGTTGAACATTTCTTCGTGTA
TATATAACTTTTTCTTAATCGTAGCAAGGTTTGTAGTTTGTTTAACATAGTACGCGATAGAACTCATCGTGAAGCAGCTCAGATTCATGG
TTTAATCTCTGCTTTGTTTAGTTACATATATAGACCATGCATATGTAATCTTGAATATGATTTGCTTTTTCTTGTATTTTCATAGTAATA
AAAGATGAAAATAGGTCATCTAGTTTTGAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
crypt2 cryptochrome 2cryptochrome
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E747557
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None