This unigene is from an out-of-date build, Coffea canephora #2
It has been split into SGN-U617131 and SGN-U617447 in the current build, Coffea canephora #3
Unigene SGN-U348199

Unigene Basic Information 
Unigene ID: SGN-U348199
Unigene Build: Coffea canephora #2
Date: 2007-05-18
Organism: C.canephora
Alternative ID: 348199
mRNA sequence: Length: 1375 bp

>SGN-U348199 Coffea canephora #2 (4 members)
CATCCTTCCACTGTCCCGGATAAAGAAAAAGATACCAACTCGATACGACTCTTCTCCAGAAAAGAAATTTACAAAAAACCGGAAGAAAAT
TTTGTTTTCAAAAAAGGTTGGTGCAGCTACGAATAAGTAGTCTTGACTTCTCAGAGTTTATTTTATTGGATTGAAGGCTAGGAGAAGAAT
GGCGGCTAAAAGGGTCTCATCGCTTCTGCTCTCTCGTTCTTTTACGTCTTCTCTTGCTTCCCGGCTAACCGGAGGAAAAAGTGCTTGCCA
AGCAAGAGCAATTTCTCGGTATAGCACTGCTGCTGCTCTCGAGGAGCCAATTAAGCCACCGGTTAATGTGGAATACACTAAGCTTCTCAT
TAATGGTCAATTTGTTGATGCAGCCTCAGGGAAGACATTTCCAACTCTGGACCCTAGAACAGGGGAAGTGATTGCGCATGTTGCTGAAGG
TGATGCAGAAGATGTCAACAGAGCTGTGGCTGCTGCTCGCAAGGCTTTTGATGAAGGACCCTGGCCCAAGCTGACTGCTTATGATCGGCA
AAGAATATTGCTACGCTTCGCTGATTTAGTCGAGAAGCATAACGACGAAATTGCAGCACTAGAGACTTGGGATAATGGCAAGCCATATGA
ACAAGCAGCTAAAATTGAAGTTCCTATGTTTGTGCGCCTCATGCGATATTATGCTGGTTGGGCCGACAAGATTCATGGGATGACCGTTCC
TGCTGATGGACCTTATCATGTTCAAACTCTGCATGAACCCATTGGTGTTGCTGGACAAATTATTCCGTGGAACTTCCCTCTCCTAATGTA
TGCTTGGAAGGTTGGGCCTGCATTAGCATGTGGCAACACCGTTGTGCTCAAGACAGCAGAGCAGACACCATTATCTGCTCTATATGTGAC
AAAGCTGTTGCATGAGGCTGGGCTTCCATCAGGTGTTCTGAATGTGGTGTCTGGCTTTGGTCCAACAGCTGGCGCTGCTCTTTGCAGCCA
TATGGATGTGGACAAGCTTGCCTTCACTGGATCAACAGAAACTGGAAAGATTATTCTTGAATTGTCTGCTAGAAGCAACCTTAAGCCAGT
GACTTTGGAACTTGGAGGCAAATCTCCTTTTATTGTTTGTGAGGATGCTGATGTGGACAATGCTGTCGAGCTAGCCCACTTTGCACTTTT
CTTTAACCAGGGACAATGTTGCTGTGCTGGCTCCCGCACATATGTTCATGAACGTGTTTATGATGAATTTGTGGAGAAAGCCACTGCACG
TGCATTGAAACGCAGTGTTGGAGATCCATTCAGGCAAGAAATAGAACAAGGTCCTCAGGTTGACTCAGAACAGTTTGAGAAAATTTTGAG
ATATATTAGAGCTGGAGTCGATAGT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)