Unigene SGN-U565155

Unigene Basic Information 
Unigene ID: SGN-U565155
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1243 bp

>SGN-U565155 Tomato 200607 #2 (22 members)
GATCAAACTCTCTCATTTACATTAATGTTTCTATTTTCTGAGATCAGTATACTTCTCATTTGTCTAAATTAGTTACTATAATATGGCTGT
GGAGCTAATGATGGATTACAGAAGCACTAGAAATAACAATAATACTAATTGTATTAACTTCGTTGCGAAATTAGAAGAAAAATCAGTTGT
GCAAGAAGCTGCTTCTGGTCTTGAGAGTGTTGAGAAACTCATCAGATTATTATCACAGTCTCAATCTCAACAAATTCAGCAGCAAAATAA
GTCTCCAATGGAGATTGAAATGGTGGCTGATGCAGCTGTTACAAAGTTTAAGAAGGTAATTTCACTTCTAGATCGAAACAGAACTGGTCA
TGCTAGATTCAGAAGAGCTCCTTTGGCTAATAATAATTCTCCTTTGCCTTCAAATTCTAGTAAAGATTTTGTGGATACAAAAGTGTATTC
TCCAACTCCGATCCAACAAGTTCCTTTAATTACCTATGACCATTTTAACCCTCTGGTTCCAAAGACGATAAGTTTCTCCTATTCACCGGA
AATGTCTCGCACAAATTCCTTCAATATCTCGTCGTTAACAGGGGAAACAGAGAGCAAACAACATTCTTCATCTAATTCAGCTTTCCAGAT
GACCAATCTTTCTTCTCAAGTCTCTAATTCTGCCGGAAAGCCTCCATTGTCTTCTTCTTCACTGAAACGAAAGTGCAGTTTATCGGAAAA
TGCCGTATCTGGAAAGTGCAGTGGATCTTCCGGCCGATGCCATTGTTCCAAGAGAAGAAAGTTAAGACTAAAGAGGGTAGTTCGAGTACC
GGCAATAAGCATGAAACTGTCAGATATCCCACCGGATGATTACTCATGGAGAAAATATGGACAGAAGCCAATCAAAGGATCTCCACATCC
AAGGGGATATTACAAGTGTAGTAGTGTAAGAGGGTGTCCAGCACGTAAACATGTTGAAAGAGCATTGGATGATCCAACTATGCTGATTGT
TACCTATGAAGGAGAACATAATCATTCACTTTCTGTTGCTGAAACAAGTAGTCTCATTTTAGAGTCTTCTTAAGTAATTAGGAATCAAAA
ATTGTGTAGCTTCTCTGAAAAGACCAAGGCTTTTCCAATCAATGTAAACTCGTTGTTGATTAGATTACTTGATCAATCTGTTGAAGAAAT
TCAACATCCCTCTCAAATGAGAGTTCGCATCGTAATTAAGTATTTTATTATGCGAAACTAAATTGTATTTTCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlWRKY8 WRKY transcription factor 8transcription factor
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (22)  
Alignment image suppressed for unigene with 22 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 1 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)