Unigene SGN-U566366

Unigene Basic Information 
Unigene ID: SGN-U566366
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 917 bp

>SGN-U566366 Tomato 200607 #2 (61 members)
GATTGGCGGCCAAATCGGCCGAATTGGAAGACGAAGGTTCTGGTTTTTATTATCCTATCCAAATACTCAGCTCAGTGTTGTTTCTTCCTT
CAACAAAAGGATTTTGCAGAAGGTTTTGAACAATGGCGGCTCTGCAGAGCTCCTTTACTGGTCTCTCCATCTCCTCCACCTCCTTCTTCG
GCCAACGCTTCTCTCCTCCTCTCTCCCTTCCTCTGGTTAAATCAGCAGAAGGTCCATGTTTGATTACAGCAAAGCTTAAGCGATGGGAGC
GTAAAGAATGTAAGCCAAACAGCCTTCCAGTACTACACAAAATGCATGTAAGGCTGGGTGATACTGTAAAGGTAATCTCCGGCCATGACA
AAGGTAAAATTGGAGAGATTACCGAGATCATCAAGCACAACAGCAAAATAGTAGTAAAAGAGGTGAACTTGAAAACCAAGCATGTGAAGA
GTCGGAGTGAGGAGGAACCAGGCCAGATAGTCAAGATTGAAGCTCCTATTCACAGCTCAAACGTGATGCTTTATTCAAAAGAGCAGAAGG
TAGCCAGTCGGGTTGGTCACAAAACTTTAGACAATGGAAAAAGAGTCCGGTACCTCATTAAAACTGGGGAAATCATCGATAGTGCAGAGA
ACTGGAAGAAAGCAGTCAAAGAGAAGGGGAAAACAACAGAAGCAGTAGCTGCTGCTTCCTAGGAGATCCACTGGTCTGTAAATTCTAGTT
CGATTTTGCTAATTTTGAATCTTCTCTCATTGATATATTATGATTCTGTTGTCACCTTCACCTTTTTAACTCAGTAACATAAGATTTTAT
ATTAAAGTACATTTACTCAAAAATTCTGTTTGCCAGTACTATTACGTACTAGAGTTTGATGGTTAATGGGTCGAATACAATGATCTTTAT
GTGCTTTATGATTAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc07g063960 Solyc07g063960
Genomic locations (0)None
Library representation (18)  
mRNA member sequences (61)  
Alignment image suppressed for unigene with 61 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 2 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)