Unigene SGN-U569247

Unigene Basic Information 
Unigene ID: SGN-U569247
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1537 bp

>SGN-U569247 Tomato 200607 #2 (64 members)
ATATAATATTATTATTTACTAATAATATACCAAATTTTTTATTATTTTTTATATTCATTTTAGTAACAAACTCAAATCAGTTATTGGAAC
AGAAAAAATAAAAAATAAAAAAATATGCTAAGCATCAGAGTAACAGCAACCATTTCTTCTTCTTCAACTCTTTTCTTTACAAATTCCAAA
AAAATTTCGAATAAATTCTCTTACATTTCAAATCCATTGAAAAATTCTTCAAAACCCATTAAATGGAACTGTAAAAATTCAAGAATGGAG
TCATCAAAATCAAGTTTTGTTACCAAAGCTTCAGCACAGCCACTTACAAATCCTGCAGAACTCATTGATTCTGTTGAAACTTTCATCTTC
GATTGTGATGGAGTTATATGGAAAGGAGATAAACTGATAGACGGAGTCCCTGAAACTTTGGATTTGCTCAGGGAAAAGGGAAAAAGATTA
GTTTTTGTTACCAACAACTCAACAAAGTCTAGAAAGCAGTATGGGAAAAAATTTGAAACACTTGGTCTTAGTGTCAACGAGGAGGAAATT
TTTGCTTCATCCTTTGCTGCAGCTGCATATTTGAAGTCTATTGACTTCCCAAAAGATAAAAAGGTGTACGTTGTTGGTGAGGATGGCATC
TTGAAGGAGCTTGAGTTAGCTGGTATTCAATATCTTGGAGGACCGGAAGATGGTGACAAGAAAATAGAGCTAAAGCCTGGATATATGATG
GAGCAGGATAAAGATGTTGGAGCTGTTGTTGTTGGATTTGACCGCTATTTCAACTACCACAAGATTCAGTATGCTACCCTGTGCATACGT
GAAAATCCAGGATGTCTCTTCATTGCTACAAATCGTGATGCTGTTACCCATCTTACAGATGCTCAGGAATGGGCAGGTGGTGGTTCAATG
GTTGGTGCGATCCTAGGCTCTACAAAGCGTGAACCACTTGTTGTAGGAAAGCCCTCAACCTTCATGATGGACTACTTGGCTGATAAGTTT
AAGATACAGAAGTCGCAGATATGCATGGTCGGTGACAGATTGGATACAGATATAGTGTTTGGACAAAATGGTGGCTGCAAAACTCTTCTG
GTTCTCTCAGGCGTGACATCTCTATCGATGCTTCAAGATCCCAGCAACTCTACACAACCGGATTTCTACGCCAACAAGATTTCTGATTTC
CTCTCCATTAAAGCGGCTGCAGTTTGAGCAAATCCACTGATTACGCGTGGCGATCCCATTCTTTGTGTTTGATGTGTTTACAAATGCACT
TCATTTATGCATCCCAGTTTTCTCTTGTAGCTAAAAGAAGATGGGAGTTGAAATTAGGCATATGAGAAATTGCATAATGCAATGTAAAGT
GTACCATTTTAACTTTCTAGATATAATAATGGAAAAAAAATGGAGTCTAAGCTTTAAAATCATGATGTAGTGAGGCATCTTTTGATTATT
TTTTCTTGTTTGGTGCATAATGATGCAAAAATTGGAATGTCATGATTCATATGCTTCAATTTAGTGAAGATGGAATGTCAATGCTATTGT
GTCCATG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (64)  
Alignment image suppressed for unigene with 64 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 2 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)