Unigene SGN-U570910

Unigene Basic Information 
Unigene ID: SGN-U570910
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 2072 bp

>SGN-U570910 Tomato 200607 #2 (76 members)
CACTTGAATGGATGGGTACGGAGGAAGTTAGTAGTGCTTTCTTTTTATACGACTTATTCATGATTATTAAAAACTCATATGTGGTGTCAT
CACTGAGTTGGAGTCCCTTTTAATCAATTTTTTTTTTCTCTCTCTTTTGGCTGGGTCTTTTATTTTTTTTTTCTCTATATATATTGCACC
TTCATTTTTTTCTATGCATGTTTTATTTTTACAATATTTGATTTGTAATTAAACAACAAATTGATTCGAAGGATTTTATCAAATGGCCAA
GATTTCTCGTCTTTTTGGATCCACCGTGAAAGCAGCTATCACCGCCCAGGCTGGTTTCCATGGAAAACGTATTCCAGCAGTTAGCAGTTT
ACAGGAGCATATTGTTAAATCAACACCGGCAAGATATAACAGTACACAGGCATGTTTGGAAAATGATATTTCTGGAACTGATAATAAAGG
GTTCAAGGGTCATGATATGTTGGCACCCTTCACTGCTGGGTGGCAAAGTACTGATGTTGATCCTTTGATTATAGAGAAGTCTGAGGGATC
CCATGTCTATGACATGCAAGGGAGGAAGTATATTGATACTCTAGCTGGTTTGTGGTGCACAGCACTAGGGGGGAACGAGCCTCGCCTGGT
TGATGCTGCCACTAAGCAATTAAACACATTGCCGTTTTACCATTCATTTTGGAACCGTACAACAAAACCTTCTTTGGATCTTGCGAAGGA
GCTTCTAGATATGTTCACTGCAAAGAAAATGGCAAAAGCTTTTTTCACCAATAGTGGATCAGAAGCCAATGATACCCAGGTGAAGCTGGT
CTGGTATTATAACAATGCTCTTGGAAGGCCAAACAAAAAGAAATTTATAGCTCGAGCAAAAGCATATCATGGTTCAACTCTTATTTCTGC
CAGTCTCACTGGCCTTCCTGCATTACATCAAAATTTTGATCTTCCTGCTCCATTTGTTCTTCACACCGACTGTCCTCATTATTGGCGTTA
TCATCTGCCAGGTGAGACAGAGGAGGAGTTCTCCACCAGGTTGGCTAAAAATTTAGAAGATCTTATCCTCAAAGAGGGGCCTGAAACAAT
AGCTGCTTTTATTGCTGAACCAGTCATGGGGGCAGGAGGTGTCATACCTCCTCCAGCTACCTATTTTGATAAGATCCAAGCTGTAGTGAA
GAAATATGACATTCTTTTCATTGCGGATGAGGTCATCTGTGCCTTTGGGAGGCTTGGAACAATGTTTGGCTCTGACATGTATAACATCAA
ACCTGATCTTGTCACCTTAGCAAAGGCTCTTTCTTCTGCATATATGCCTATTGGAGCTGTCCTTGTAAGCCCCGAAGTTTCTGATGTAAT
TCATTCTCAAAGCAATAAACTTGGTTCCTTTTCCCATGGATTCACTTATTCTGGGCATCCTGTTGCATGCGCAGTGGCATTGGAAGCTAT
TAAAATCTACAAGGAGCGAAATATGGTTGAGAGAGTAAATAGAATATCCCCAAAGTTTCAAGAAGGTCTGAAGGCATTTTCTGACAGTCC
CATTATCGGAGAGATTAGGGGACTTGGTTTGATCCTTGCCACAGAGTTTGCGAACAACAAATCTCCTAATGATCCTTTCCCTCCCGAATG
GGGTGTTGGTGCATATTTTGGAGCGCAATGTCAGAAGAATGGCATGTTGGTACGAGTTGCTGGTGATACCATCATGATGTCTCCTCCATT
TGTAGTTACTCCAGAAGAACTTGACGAGTTGATTAGAATCTATGGGAAAGCATTGAGGGAAACTGAAAAGAGAGTAGAAGAACTCAAGTC
TCAGAAGTAATATTAGTTGACAGCACAAGCTTGACGATGGCGAAAAATAAAATCAAATGTGTTTGGATATTCTGTAAATGTCCAGAATGA
AGTAAAGAAAGTAATATAATTTTTAGTCCAAGTTGTTTTCTCTTTCATTTTACATGCAGTATAGTTGCACCAGTTGACTTGTTGATGAAT
ATATGTATCCCCTTAACCAGTAATCACCAAATTGCATTTCACAAAAAAATCGAATTATCAATCTATATTCTTGTAATTAATTGGGTTTTT
AT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
GABA-TP1 Gamma aminobutyrate transaminase isoform 1Gamma aminobutyrate transaminase
Genomic locations (0)None
Library representation (22)  
mRNA member sequences (76)  
Alignment image suppressed for unigene with 76 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 3 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)