Unigene SGN-U576773

Unigene Basic Information 
Unigene ID: SGN-U576773
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1434 bp

>SGN-U576773 Tomato 200607 #2 (24 members)
GACAAGTAGTGCCTAGGCAATTTATGGATCTTGGCTTAGCTGCTGGTGCTGGTGGTACTGCTTCTGAAGCGGAAGAGGCTTCCCTGTCTT
CGTCAGAGGGGCCAAGTGGCAGGGAAAAATCGCGATCACCAGTGAATAACATTGAATCTAGTTCCACATGTGGGATTGTAAGAGAAGATA
GTCCTGAAAAAGTGTCACCTGGTTGGGGTCCTAATAAAATTCCAAGACTTGGTAATACCTCTACTAATAATAAACCTGCTGATCAAGCTA
CTGAGGCTACTATGAGAAAGGCTCGGGTCTCGGTCAGGGCTCGATCAGAAGCTCCCATGATCACAGATGGCTGTCAATGGCGAAAGTATG
GGCAGAAAATGGCTAAGGGAAACCCGTGCCCTCGAGCTTATTACCGGTGCACCATGGCAGCTGGTTGTCCAGTTCGGAAGCAAGTTCAAA
GATGTGCAGAGGACAGAACAATCTTGATCACAACTTATGAAGGTACTCACAACCATCCGTTGCCTCCGGCAGCCATAGCGATGGCCTCGA
CAACTTCCTCAGCAGCGAAAATGTTGCTCTCGGGCTCTATGCCAAGTGCAGATGGGCTAATGAATTCCAATTTCTTCGCGAGAACTCTCC
TTCCTTGCTCTTCCAGCATGGCCACAATTTCAGCCTCGGCCCCGTTCCCTACTGTTACATTGGACCTAACTCAATCCCCGAACCCGTTGC
AATTCCCAAGACCCCCTAACCAATTCCAAATCCCATTTTCAAATCCACCTCACAACAACATCCTAGCAAATCCAGCTGCACTTTTGCCTC
AGATATTTGGACAGGCTTTGTATAACCAATCCAAATTCTCTGGCCTCCAATCATCTCAAGATTTAGAAGGACAACAACACCCTTCAACGA
TGCCATCCTCGATTAATCCATCCAACCACAATCCTGTAGCTGACACGGTGAACGCCTTAACCAGTGATCCTAATTTCACCGCAGCATTAG
CAGCAGCCATCACTTCACTTATTGGCAATCCGGGGCAACCAAACAATGGTACCAACAACACCATCGCCACCACCACAACGCCAGCCAACA
ACAATAACAACAGTGTCACAAGCAATGGCAATAACAACAACAATGGCAGCAACAATAAAGTGACGAATTCGAGTTTTCCAGCAAACTGAT
TGATAGCTTGTCAATTAAACTGCTGCGCGCATATTTTCCTTTCAAGAAAGAAATTTTTTTCTTAAATTAATTTTTTTGCTTAACTAGTAA
TCAGGAAAACTAGATTACTATACAAGTTGATAAGATTCTTTTTGTGTGTTTTATACGTGGCTTAAAACATATAATCTTCCATTCTTTTTG
TGGCTGAATAATGTAATTCAAGATTTCTTATCAATACAAGAAAATATATTGGCAAAGGAAAAGTACAGAAATGTTCTTCCTTCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlWRKY17 WRKY transcription factor 17
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (15)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)