Sol Genomics Network

Unigene SGN-U578089

Unigene Basic Information

Unigene ID:	SGN-U578089
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 784 bp

>SGN-U578089 Tomato 200607 #2 (121 members)
GGGGACGCTAGGGTTTCAGTTGCTCTCTCTTTTCACAAGCAATTACAGCGAGAGCAGAAGAAGAAAATGCCGGCCGGTCATGGTTTGAGG
TCTCGAACGAGAGATTCATTCTCTCGCGCCTTCAGGAAGAAGGGTACCATCGCACTTTCGACCTACTTGAGGATTTTCAAAATCGGAGAT
TATGTTGATATCAAGGTGAATGGTGCTATTCACAAGGGAATGCCTCACAAGTTCTACCATGGACGTACTGGTCGTGTTTGGAATGTTACC
AAACGCGCCGTTGGTGTTGAAGTCAACAAGCAGGTTCGTAACAAGATCTTAAGAAAGAGGATCCATGTGAGGATTGAGCATGTCCAGCAA
TCTCGATGCACCGAAGAAGTCAGGGAAAGGATCAAGAAGAATGACCAACTTAAGGCTGACGCCAAGGCTAGAGGAGAAGTCATCAGCACA
AAAAGGCAACCACTAGGACCCAAACCAGGGTTCATGGTTGAAGGTGCTACTCTGGAGACAGTTACCCCCATACCATATGATGTGGTTAAT
GATTTGAAGGGAGGATATTGATCTTAATCTGTTTCTGAGAGGTTGTTTTTTCTATTTGGTTTTTCTGAAATTGAAAGACAGAATTAGTTT
TGTTGGTGTCAACTCCAGACATTGCTTGTTAGTTAAATTTTGTTTACATTGCCATTAGAGGCCTTTTGTTGAACTTTTACTACAAAGGTG
AATTCAAGTATGTCTATCTATTACCTAAATTCCCTGCATTTTAAGATAATTTTCTTGATAANAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (29)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	6
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	6
Solanum lycopersicum	LA	Leaf Mature leaves	6589	4
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LeMiToFr02	fruit	18697	4
Solanum lycopersicum	LeMiToLf01	leaf	30679	12
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	5
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	6
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	7
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	9
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	4
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	3
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	4
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	6
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	6
Solanum lycopersicum	cTOS	suspension cultures	8026	10
Solanum lycopersicum	cTSB	seed	1880	2
Solanum lycopersicum	cTSD	seed	1504	4
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (121)

Alignment image suppressed for unigene with 121 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (6)

Annotations (manual: 3 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U312965	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: