Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U578218

Unigene Basic Information 
Unigene ID: SGN-U578218
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1000 bp

>SGN-U578218 Tomato 200607 #2 (195 members)
TAGGGCGATTGGCGGCCAAATCGGCCGAATTGCTCTTCTTCCATTTCTTTCAAAATTAAAGTATTGTTACTCTGCTATTGGCTCAAAACC
TCTGCAATCTCCGTCTCCTTCAATTTCAACTCAAGCAAATCCACCTCTTTCACTAGTTTCATCACTTTCAGATCAGGGTTTGGAGTTGAA
GGTACGGGGGGCTAATTGATGGCGTCGAAGAGGATATTGAAGGAGCTCAAGGATCTGCAGAAGGATCCCCCCACATCATGCAGTGCTGGT
CCAGTGGCAGAGGATATGTTCCATTGGCAAGCAACAATCATGGGGCCTACCGATAGCCCTTATGCTGGAGGTGTATTTTTGGTTTCAATT
CATTTCCCTCCAGATTATCCTTTTAAGCCTCCAAAGGTTGCCTTCAGAACTAAGGTTTTCCATCCCAACATCAACAGCAATGGAAGTATT
TGTCTGGATATTCTTAAGGAGCAGTGGAGTCCAGCATTAACCATATCCAAGGTCCTGCTGTCCATCTGCTCTCTGTTGACAGACCCAAAC
CCAGATGATCCTCTTGTACCTGAAATTGCTCACATGTACAAGACTGACAGGGCCAAATACGAAACCACTGCTCGTAGCTGGACTCAGAAA
TATGCAATGGGATGATGCGCAAAATTGTCTCCAGGCATGTCTGGGACTTTTGTAACAGCAATGTCTTATTGTGCTTGGGGTGAATGAATA
AATTCCGTGAAAGAACTTAGTTACTTCTTAATCTCCCTTCATGAGGGTTGTTAAGGGAACAGCTGTTTTCAATTTGTGAATATTTATTTG
ATGACTAGTAAGGGAGAAACTGCAATGTAATTCTACTTTGTTTGCCAGTTTGACATGCGCCTTTCCCCAAATTTGTCTGACAAATATAGT
TTACATCTTTGAATTCTGGGATTGATTTACAAATTATCAAACACTAGTTTTTCATCATGTTCTATTGTTGAAAATGGAAATGATGACAAG
TAATTTTATT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
ubca ubiquitin carrier
Solyc06g007510 Solyc06g007510
Genomic locations (0)None
Library representation (37)  
mRNA member sequences (195)  
Alignment image suppressed for unigene with 195 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (5)  
Annotations (manual: 3 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)