Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U578484

Unigene Basic Information 
Unigene ID: SGN-U578484
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1441 bp

>SGN-U578484 Tomato 200607 #2 (220 members)
GTTGAAATGTAAGGTTCTTGGCTTCTTAGCCATATGATATTAAGGCAAAAGTAAGATACAACATTGAATCTCCAACGTACAAACCTCATC
TACAATGGATTGAAGCTCTCATTTGCTTAGCCATCACTTTCAACATTGTCTATTGGATTGGTTATATGTAAGAGTTCAAAAGCAGCAATA
ATCAAGAACACATCACTAGCTATACTATTACTAGTTAGTAACAAAGTAGTATAAAGGGCAAGCAAAAGCTAAAGGAAGCTCATTGAGAAA
TGTCAACTGCTTCCATTAACAATTGCCTTACTCTCTCCCCTGCTCAAGCTTCCCTTAAGAAACCTACTCGTCCCGTTGCCTTCGCAAGGC
TTGGCAACTCTTCTTCTTCTTCTTCTATTCCAAGTCTCATCAGAAACGAGCCCGTCTTTGCTGCCCCTACTCCCATCATCAACCCCATTG
TGAGAGAAGAAATGGCAAAAGAATCCTACGATCAAGCCATTGCTGCACTCGAGAAACTCCTCAGCGAGAAAGCAGAACTTGGACCAGTTG
CTGCAGCAAGAGTTGACCAGATCACTGCTGAATTGAAATCAGCAGACGGCGGCAAGGCATTCGACCCTGTTGAGCACATGAAAGCTGGCT
TTATTCATTTCAAGACTGAGAAATATGACACAAACCCAGCCTTATATGGTGAGCTAGCAAAGGGCCAGAGCCCTAAGTTCATGGTTTTCG
CGTGCTCTGACTCACGAGTCTGCCCATCCCATGTCCTCAACTTCCAACCTGGTGAGGCATTCATGGTTCGTAACATCGCCAACATGGTCC
CTGCTTATGACAAGGTCAGGTACTCTGGAGTAGGAGCAGCCATTGAATACGCCGTTCTTCATCTTAAGGTGGAGAACATCGTTGTCATTG
GCCACAGTGCTTGTGGAGGTATCAAAGGTCTCATGTCACTACCTGAAGATGGTAGTGAATCAACTGCCTTTATTGAGGATTGGGTAAAAA
TTTGTTTACCTGCCAAGGCAAAGGTTCTGGCCGATCACGGAGGGAAAGAATTTGCACATCAATGCACAGCTTGTGAGAAGGAAGCTGTGA
ACGTTTCACTTGGAAATCTGCTTACGTATCCATTCGTGAGAGAAGGATTGGTGAAGAAAACATTGGCATTGAAGGGAGGTTACTATGATT
TCGTGAAGGGTGGATTTGAGCTGTGGGGACTTGAGTTCGGTCTTTCTCCTCCTCTTTCCGTATGAACTTAATTCAATTACCATTTGGCCC
TCACAATTTCCTTCCTTTTTTTTTTTTTCGCCTGACAGTACTTTTGCTTCGCAAAATCAACTGTGTGTATGTTGTTTGTATGTATTATGT
ATGTATGAATCAAATATGGAAGAGCACTCGTTGTTATATTTCTGAAATAAATAAAATGGAGACTACTTTTGGTATAAAAAAAAAAAAAAA
A


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ca2 chloroplast carbonic anhydrasechloroplast carbonic anhydrase
Genomic locations (0)None
Library representation (24)  
mRNA member sequences (220)  
Alignment image suppressed for unigene with 220 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (16)  
Annotations (manual: 5 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (3)