Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U578741

Unigene Basic Information 
Unigene ID: SGN-U578741
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 2750 bp

>SGN-U578741 Tomato 200607 #2 (159 members)
GAATTGGCTCATTTCGCAGTTGTTTACAGTTTTCCTAAACGGAACTCTACCATCTCTTTTTTCCGGTTACCGTTTAGGTTTCCGACCAAT
TTTCTTCTTCTCCGGTGAACTATTCCGGTTAAAAGTTGTATGGTGGGGTGTTTGTTTGAATCTTAGGTTTGTGTTTCTGTTGGTTTTGAG
TTTTAATTCTTTGTTTTGATTTAGAAAATTTTGCTTCTTCTGAAGTCGTTGTGGGGATATTCGGGTCGTGTAAGAGTGTGTTAGAAGGTG
ATTATCTTTTGATTAAGTTCTTTTTTTGCTTCTTTTGAGGGGGTAGCCGGGGCTCTGGCCTCGGCGGGTTCTAAAGCCCCCAGCTATTAC
AACATTGGTCAACAAATCATTTCTGTATAATTAGTTTTACACATTCTTTGATTCTTTTTTTTTTGTGAAGATTTTACGAGATGCCTGCTT
TAGGTTGTTGTGTAGAATCTGCTGTTTCCCCTCCTCTTGGCTATTCCTTCCTTTCCACGCCGGAGATTTTTTCCTCCGGCGTACCTCCGT
CGACAAACGCTGTCCCTCTTACCACCCATTGGTCACCGGAGCTGTCATCTGATCTGTATCGTATTGATGGTTGGGGTGCTCCGTATTTCA
CCGTTAATTCTTCCGGTGATATATCTGTCAGGCCCCATGGTACAGATACCCTTCCTCACCAAGAAATTGATCTCCTGAAGGTCGTGAAAA
AGGCTTCCGACCCGATTAATTCTGGTGGGCTCGGGTTACAGCTTCCACTCGTTGTTCGGTTTCCTGATGTTTTGAAGAACCGATTGGAGT
CTCTTCAATCGGCTTTTGATTATGCTGTTCAATCTGAAGGATATGAGGCTCATTACCAAGGTGTTTATCCTGTAAAATGCAATCAGGACA
GGTTCGTTGTTGAAGATATTGTCAAATTCGGGACGGGTTTCCGGTTTGGTCTTGAAGCTGGGTCAAAACCTGAGCTCCTCCTGGCCATGA
GCTCTCTATGCAAGGGCAGCTCGGAGGGTCTTCTTGTATGCAACGGATTCAAGGATGCAGAATACATTTCACTTGCTTTGGTTGCAAGAA
AGCTCCAATTGAACACGGTGATTGTGCTCGAACAAGAGGAGGAGCTTGATTTGGTGATTGACATCAGCCGTAAAATGGCGGTCCAGCCTG
TAATTGGGCTCCGGGCTAAGCTTAGGACCAAACATTCCGGTCATTTTGGATCCACTTCTGGAGAGAAAGGCAAGTTTGGGCTTACAACAA
CTCAGATCCTTCGTGTGGTGAGGAAACTGAAAGAATCCGGAATGTTAGATTGTCTTCAGCTGCTGCATTTCCACATTGGATCTCAGATCC
CTTCAACGGAGTTGCTTGCTGATGGTGTTGGTGAGGCTGCTCAGGTTTATTCTGAGTTAGTCCGCCTTGGTGCTGGCATGAAATTCATTG
ATATTGGTGGTGGGCTTGGAATTGATTATGATGGTACCAAATCTTCCGATTCTGATGTTTCCGTCGGATATGGCCTTCAGGATTACGCCT
CTACAGTGGTTCAAGCTGTCCGGTTTGTTTGTGACCGGAAGAACGTGAAGCATCCGGTGATCTGTAGCGAAAGTGGCAGAGCAATTGTAT
CTCATCACTCTGTTCTGATATTTGAAGCTGTGTCTTCAACTACCACGCGTTCTCAAGAGCTGTCCTCTATGAGTCTCCACTCCTTCGTGG
AGAAACTCAATGATGACGCTCGTGGCGATTACCGGAATCTATCTGCTGCTGCTATTCGCGGAGAGTACGATACCTGTATGCTTTATGCCG
ATCAGTTGAAACAGAGGTGTGTGGATCAGTTCAAAGATGGTAATCTGGACATTGAACAGCTTGCTGCCGTAGATGCCGTCTGTGACTTTG
TGTCAAAAGCTATTGGTGCTTCTGACCCTGTTCGCACCTATCATGTGAATCTGTCCGTTTTCACTTCAATTCCTGATTTCTGGGCAATCG
ACCAACTATTCCCGATTGTTCCCATCCACAAGCTAGACGAACATCCTTCAGCTCGGGGAATTCTATCCGACTTGACATGTGACAGTGATG
GAAAGATCGATAAATTCATCGGAGGCGAGTCAAGCTTGGCTCTCCATGAATTGGGAAGTGGAAACAGCGCACCTTATTATCTGGGAATGT
TTTTAGGCGGGGCATATGAGGAAGCCCTCGGCGGACTCCATAACCTATTTGGCGGACCAAGCGTCCTGCGTGTGTCACAGAGCGACAGCC
CTCACAGCTTCGCTGTAACCTATGCAGTCCCTGGGCCTTCCTGTGCTGACGTCCTCCGAGCAATGCAACACGAGCCTGAACTCATGTTCG
AGACCCTCAAGCACCGTGCAGAGGAATTCGTGCACAAGGAAGAAGAAGTAGAAGTCTCATTGGCCAATAGCCTAAATCAGTCGTTCCACA
ACATGCCATATCTTGCACCACATTCATCCTGCTGTTTTTCTGGGTATTACTATTGCAATGATGAGAATATTGTTGGTGTTGGCGCAGAAT
GTGCAATAGGGGAGGAAGAGTTTTGGCCATACTGCGTTGCTTGAAGACTTTTTGTCTTTTCAGTTTGTTGTTTTAGTAATAAAGTTTGTC
GGATGGTATGTTAAATTAATGTAAATTTTTGGTGTAATTTACTAGTTGTGGAGAAAGTTATGGTTCAATCTTTGTGTAATTTTCTCCTTA
TCCTATGTAAACTTTTTCCTTATTAAATGAATTTACCTTAGAAATTATCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
adc1 arginine decarboxylase 1arginine decarboxylase
Genomic locations (0)None
Library representation (32)  
mRNA member sequences (159)  
Alignment image suppressed for unigene with 159 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (10)  
Annotations (manual: 2 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)