Unigene SGN-U579266

Unigene Basic Information 
Unigene ID: SGN-U579266
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 2869 bp

>SGN-U579266 Tomato 200607 #2 (55 members)
TCGAAAGGCGTTTCCAGCAGGTATATGTCGCTGAGCCTAGCGTTCCCGACACTATAAGTATCCTTCGAGGGTTGAAGGAGAAGTATGAAG
GCCACCATGGTGTCAAGATTCAGGATAGGGCTCTCGTTATTGCAGCCCAGCTTTCAGCTCGATACATTACAGGTCGACATCTGCCTGATA
AGGCTATTGACTTAGTTGATGAGGCTTGTGCAAATGTGAGGGTGCAACTTGATAGCCAGCCAGAAGAAATTGATAATCTTGAAAGGAAGA
GGATTCAGCTAGAAGTTGAACATCATGCTCTTGAAAAGGAAAAAGACAAGGCTAGCAAGGCTCGACTTGTTGAAGTGAGGAAAGAGCTCG
ATGACTTGAGGGACAAACTCCAACCTTTGATGATGAGGTATAAGAAAGAGAAGGAACGGGTTGATGAGCTTCGAAGGCTTAAGCAAAAGC
GCGATGAACTTACATATGCTTTACAAGAAGCTGAAAGGAGATATGATCTTGCTAGAGCAGCAGATCTTAGATACGGTGCCATCCAAGAAG
TAGAATCTGCAATAGCAAATCTTGAGAGTAGCACAGATGAGAGTACCAATGTTGACAGAGACTGTCGGACCCGATCAGATTGCGGAAGTA
GTTAGTCGCTGGACTGGAATTCCTGTCTCTAGGCTTGGCCAGAATGAGAAGGAGAAATTGATTGGTCTTGCTGATAGATTGCACCTAAGA
GTTGTCGGGCAAGATCAAGCTGTTAAAGCTGTTGCTGAGGCTGTGTTGAGGTCTAGAGCTGGATTAGGAAGGCCACAGCAACCAACTGGT
TCATTCCTTTTCTTGGGGCCAACTGGTGTTGGAAAGACTGAACTTGCTAAAGCTCTTGCTGAGCAGCTATTTGATGATGACAAATTGATG
GTCAGAATTGACATGTCCGAATACATGGAACAACATTCTGTTGCCCGGTTGATTGGTGCTCCACCAGGTTATGTTGGACATGAGGAAGGA
GGGCAACTTACGGAAGCTGTAAGGAGGCGCCCTTACAGTGTTGTGCTATTTGACGAAGTGGAAAAAGCTCACCCTGCAGTGTTTAATGCC
TTGCTTCAAGTGTTGGATGATGGAAGATTAACTGATGGTCAAGGTCGTACTGTTGATTTCACCAACACTGTGATCATTATGACCTCAAAT
TTGGGAGCAGAGTATCTCTTGTCAGGATTAAGTGGCAAGTGTACCATGGAGAAGGCCCGTGAAATGGTCATGCAGGAGGTGAGGAAGCAA
TTTAAGCCCGAGTTACTCAACAGGCTCGATGAGATTGTGGTGTTCGATCCTTTATCACACGAGCAGTTGAGGCAAGTCTGCCGTCACCAA
CTGAAAGATGTGGCAAGCCGTTTAGCTGAGAGGGGTATTGCTTTGGGTGTTACAGAGGCCGCCTTAGATGTCATACTTGCTCAGAGTTAT
GATCCGGTGTATGGTGCAAGGCCTATTAGGAGGTGGTTGGAGAAGAAAGTTGTAACGGAGTTATCAAAGATGCTTGTGAAGGAGGAGATT
GATGAGAATTCGACCGTGTACATAGATGCTGGACGTGGCGGAAAAGATCTAACATATAGGGTGGAGAATAATGGAGGGCTTGTGAATGCT
GCTACTGGTCAAAAATCTGATGTACTGATTCAGCTACCTAATGGGCCAAGGAATGATGCTGCTCAAGCAGTGAAGAAAATGAGGATTGAA
GAAATAGATGACGAAGATGATGAAATGGCAGATTAAAGAGAGGTTGAAAATAACACCATGAAAGTTGAAGATATATGAATTATTACTTTT
TGTTTAAAATACCCTGTATAGGGTTAGTCCAATTTTACATCATTAAGAAGTGAACGTTCACAAGTTCTCTGTTGATTTTGTTGTGTTGTT
TCTTTATGCAGCTTGAAAATGTCTAAATAGTAAATTGTATTTCTCTGATTTTCTGAAAAAAAAAAATCAAAGAGAAAAAATTAAGATTTT
TTTTTCAAAAAAAAAAAAAACATATGGGGAAAGCACGTATAATAGGAATTGGAATGGATTATTCAGCAACAAGCAAAATAGCTCTAAAAT
GGGCAATTGATAATTTAATTGAAGAAGGTGACACAATTATTATTATTCATGTTGTTTCTTCTAAAGTTGAACCAACTAGTAAACAACTCT
TTGAAGATACTGGATCACCTTTGATACCTTTGGATGAATTTAAACAGATTAATGTGTCTAAGTACTATGGATTAAATCCTGACAAAGAGG
TTATTGATATGCTTGAGCCTGTTGCCAAACTCAAAAAGGTGACAGTGGTGTCAAAGGTGTATTGGGGAGATGCAAGAGAGAAACTGTGTG
ATGCTGCTGAAAGTCTCAAACTTGATTCACTTGTAATTGGAGGCAGAGGCTTAGGAGTTCTTAAAAGGGTGTTACTTGGAAGTGTCAGTA
ACTATGTGGTGCAAAATGCAACATGTCCTGTTACTGTTGTGAAAACCAGTCCTCAAAAGTGAAAAAAAAAAAGACTATAAAGTTTACGTT
ATTTTCTTAATAAAAAAAAGAAGAAAAGCTATTTTGTGTTTTTACTTTCTTTCGTTTTTGTATAATGTCTTGTTTTGGATTTTATTTATT
TGATTTCTTAGGGTATGAGTTGGCTTTTGTTTGGGAGTGTTGGATGTGAGATGATTGTGGGACTTTGTTATATTTCAATTATATATTATA
TACATATTTTTGTTGGTTTCTTGTTTGTCATTTTTGAGACACTTGTCTTTGTCAAAATGTAAATGTTTCATTTGTGAGATTGGGAAGAAA
ACATTGTGAAGTTTCTTGTGATAAATATTACAATAGTTAAAATACCATACCAGTACAATTTTACGAGTGAGGTTTAACT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
tfhs1 Solanum lycopersicum heat shock protein
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (55)  
Alignment image suppressed for unigene with 55 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 3 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)