Unigene SGN-U580398

Unigene Basic Information 
Unigene ID: SGN-U580398
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1137 bp

>SGN-U580398 Tomato 200607 #2 (24 members)
GGCGATTGGCGGCCAATCGGCCGAATTCCATGGGGATCCGATGGCCACCCTAGCTAAATTAAATATTATTCTACGAGTGTGTATAAATAT
ATAGCTGTACATGGTCCTCCTCCGTTTTAAAAGCAAAAATAAAACCATTTCATTAATTTGACGAGAAATTAAAATGGCGAAAATTGCTGT
TGGAAGTAGCCGTGAGGCTATTCAGCCTGATTGCATCCAAGCCCTCATTGTTGAATTTATTTGCACTTTTCTCTTTGTTTTTGCTGGTGT
TGGATCTGCCATGGCTGCAAATAAGCTAAATGGAGATCCACTAGTGAGTTTATTTTTTGTGGCAATGGCACATGCATTGGTGGTGGCTGT
GACAATCTCTGCTGGTTTTCGTATTTCTGGTGGGCACCTTAACCCTGCTGTCACACTTGGCCTTTGTATGGGTGGTCATATCACTGTCTT
TAGATCAATCCTTTACTGGATTGACCAATTACTTGCTTCTGTTGCTGCTTGTGCTTTGCTCAATTACCTCACCGATGGAATGATAACACC
AGTTCACACCTTAGCAAATGGAATGAGCTATGGGCAGGGGTTAATTATGGAGGTGATTTTGACCTTTTCTTTGTTGTTCACTGTGTATAC
AACACTTGTGGACCCCAAGAAAGGAATTCTTGAAGGAATGGGCCCACTTCTAACTGGGCTTGTTGTTGGGGCCAATATTATGGCTGGTGG
GCCTTTTTCAGGAGCTTCAATGAACCCAGCAAGGTCATTTGGGCCAGCTTTTGTAAGTGGAATCTGGACTGACCATTGGGTCTACTGGAT
TGGGCCTTTCATTGGTGGTGGGCTTGCTGGTTTTATTTGTGAAAACTTTTTCATTGTTAGGTCTCATGTTCCTCTTCCAAATGAAGAGAC
TTTCTAGGGTTTTGTAACAAAAGGCTCTTTATCTATTCTTGTAGTTTTGGAAGTCTACCTTATCTATGCATGTATTTTTTATGTTATCCT
TTTTGTAACTTTATATTTTAATAATACTTTCGCTAGACTTGCTACGATTATTTCATTACGAAACTAAAGTACTAAACTACCCCGTTTGGT
CATGTGATATTGGTATCATGATATGAAATCAGAAGATGAAATTGAAGTTTTGTCTGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlTIP4.1 tonoplast intrinsic protein 4.1water channel protein
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)