Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U585333

Unigene Basic Information 
Unigene ID: SGN-U585333
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1020 bp

>SGN-U585333 Tomato 200607 #2 (27 members)
AGAGAAGACTGAAAGACGAAGAAGAAACTTCCAGAAGCTCATAGAAATGGTGTCGATTGAACAAGTAGAATCACCGGCGGCCGGTAAAAC
TTCGACGGCGGCAGAAGCACCGTCTGGTTACGTGTCGGATGGATACGAGACTGCGAGCGATTCGGAACTGAATGGAGCCGAGAATGGAAG
TAATAGGGAATCTGAGAACACGATCAATACAGCGTCGTCTTCATCTGATGGAGATTTTTTGAAGGAGAAGACGCAGGAGCAGCAGCCTGA
AGTAAATCAGGAACAGTTGAATGAGAAAGCATTGGCTCAAGCAAATGATGCGAAAGTTGAAGGCAATGCATTGTTTAAGGATGGGCTTTA
TGAAGAGGCATTGTCGAAATATGAGCTAGCTTTGCAAGTCGCAGCAGATATTCCTTCAAGTACTGAAATTCGTTCAATATGCCATGCTAA
TCGAGCAGCTTGTTTCACCAAACTGGGGAAACATGAGGAGACGATCAAGGAATGCACAAAAGCATTAGAACTAAATCCTACATATATAAA
GGCTCTGGTTAGAAGAGCAGAGGCACATGAAAAGCTTGAACACTTTGAAGAGGCCATTACTGACATGACAAAAATCTTGGAATTGGAACC
CTCACATGACCAAGCTAGGAGAACTGTGATACGTTTAAAGCCATTAGCTGATGAGAAGCGAGAAAAGATGAAAGAGGAGATGATTGGCAA
GCTCAAAGAAATGGGAAATTCCATTTTGGGTCGATTTGGTATGAGCGTTGACAACTTCAAAACAGTTAAAGACCCAAACACCGGTTCCTA
CTCTGTTCAATTTCAGAAGTGATGAGGGTTTCTCACATGTTGGCGAAATTTGCATTTCTTGAATGAAAGATTTGATCAAACAGGACACAT
TTGGGTGTGCATGTTTTGAACTATGTATCACGTTATAGCTTTTGAAGTATATAAGTGTTGGCCAAAAACTTGATATTTTAGATTTCTATA
CTGTTATAGAACCAGATGGCTTGTAGCCTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ddtfr5 ripening regulated protein (DDTFR5)
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (27)  
Alignment image suppressed for unigene with 27 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)