Unigene SGN-U595562

Unigene Basic Information 
Unigene ID: SGN-U595562
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 4499 bp

>SGN-U595562 Tomato 200607 #2 (1 members)
AAAAGGTGATTAGATAGAACGTGATATACATGCGGCTTATCGAGGACATGATTTTATATAGACCAACGTAGATTCTTGATTCTTCTTTCA
GTTGTGGTAACTTTCAGCTTAGAAAGTAGAAAAAAGACAAGATTTTTGATAAAGGGTCTGTGTGAAGTCAACTGCTATTACATTAATGGA
TGAAAGACAAAAAAAGGTGAGTTTGGTTTTGGCAGTTAATGGAGAGAGGTTTGAGTTGCCATGTGTTGATCCTTCTACAACTTTGCTTCA
CTTCTTGCGCTCTGAGACTTGTTTCAAGAGTCCAAAGCTTGGTTGTGGTGAAGGTGGTTGTGGGGCTTGTGTTGTTCTGGTCTCGAAGTA
TGATCCCAATCTTAAAAAGATCGAAGATTTTAGCGTGAGTTCGTGCCTTACACTTCTTTGCAGTTTGAATGGTTGTTCAATTACTACAAG
TGAAGGCCTTGGGAACACCAGAGATGGTTTTCACTCTATTCATGAAAGGTTTGCCGGTTTCCATGCTTCTCAATGCGGCTTTTGCACTCC
TGGCATGTGTATGTCATTTTTTTCAGCTCTTGTCAATGCCGATAAAGGAAACAAACCCAATCCTCCACCAGGATTCTCTAAGCTTACTTC
GTCTGAAGCTGAAAAGGCCATAGCAGGGAACCTTTGTCGATGCACTGGATACCGGCCTACTGCTGATGCCTGCAAGAGTTTTGCTGCTGA
CGTTGATATCGAGGATTTGGGGTTCAATTCTTTTTGGAAAAAAGGAGATTCCAAGGAAGTGAAAGTAAGTAAGTTACCTCCCTATGATCC
AACCAAGAATTTCAGTACGTATCCCGAGTTCTTGAAAAGTGAATCTGCCACGAATTCAGAATCCTCAAGGAGGTACCCTTGGTACAGTCC
TGTTTCCATTGAGGAGCTACGGAGCTTGTTGAACTCCAATGTGATGGAAAATGGTGCAAGCTTCAAACTTCTCGTTGGGAATACCGGCAC
AGGTTATTATAAGGAAACTCAGCGATATGATCATTACATTGATCTCAGGTACATTCCTGAACTCTCAATCATCAAAAGAGATCAGACTGG
CATTGAAGTTGGAGCTGCTGTGACTATCTCTAAACTGATTTCATTCTTGAAAGAGGAAAACAAAGTCAATTTGGGTTCATACGGGACGTT
GGTGTCCCAAAAACTAGCTAACCACATGGAGAAGATTGCTTCACCATTTGTTAGAAACTCGGCTAGTATGGGGGGAAATTTGGTTATGGC
ACAGAAGAATGGTTTTCCTTCAGATATTGCTACATTATTTCTTGGACTTTGTGCTACTGTTAGCTTAATGACCAGTCATGGAGTTGAAAA
GCTCACATGGGAGGAGTTATTATCGGGACCACCGCTAGACTTAAGGAATGTGCTTCTAAGTGTTTTCATTCCATTTAAGCAAGATCAAAG
TTCTTCAGAAATTCATTCTAAATTTCTGTTTGAAACCTTTCGAACCTCTCCACGACCTCATGGGAGTGCATTGGCATATATAAATGCCGC
TTTCCAGGCTGATGTTTCTCTCTGCCAGAAGGGCCTCTTGATAAACAATATACAGTTGGCGTTCGATGCTTATGGTACAAAACATGCAAC
AAGGGCTAAAAAGGTAGAGGAATATCTAACCGGGAAGATATTAAATATACATGTTTTATATGAAGCACTTAAATTAGTCAAACTAGCAGT
GGTACCAGAAGATGGCACTTTACACCCCGAGTACAGATCAAGCTTGGCCGTCAGTTATGTTTATGAGTTTCTTCATCCCTTCACTGATGT
TCATTCTGCTATTTCTGGTGGTTTACACAACGGAATTAGTGACATCTTGGTTGAGGAACTTCCCGAAAGTTGTAATGATGGTTGCATTAG
TCAGGAGAGAGAAAAAACACTACTGTCTTCTGCAAAGCAAGTCGTGGAATTAAGCAACGACTACTATCCAGTAGGTGAACCCTGAAGAAG
GTTGGAGCTGCCATGCAAGCTGCTGGTGAAGCTGTTTATGTAGATGACATTCCTTCACCACCAAACTGCCTGCATGGAGCATTTATCTAT
AGTACAAAATCATTAGCAGGTGTAAAGGGAATCCAGCTTGAGTCGAATCGATCAACAGATGGAGTCACCACCATTATTACTTCTAAAGAT
ATTCCAAGTGGAGGGGCAAATGTAGGAGTTATTACAACGTCTGGTCCCGAGCCATTATTTGCAGATGATATCGCCCAATGTGCTGGTGAT
AGAATTGCTCTTGTGGTTGCTGACAATCAGAGGTCTGCTGATGTGGCTGCAAGAACAGCCCTCGTTGAATACGACACTGAAAACATATAT
TCTCCCATTTTAACCGTTGAGGAAGCTGTTGAGAAATCTAGCTTTTTCCAAGTCCCGCCATTTTTTAATCCAAAACAGGTTGGTGATTTC
TCAAAAGGAATGTCTGAAGCAGATCACAAGATTCTCTCTGCCGAGATAAGACTCGGTTCGGAGTACTATTTTTATATGGAGACACAGACT
GTCCTTGCAATTCCAGATGAAGACAACTGCATGGTTGTTTATACTTCAAGCCAGTGCCCTGAAAACATTCATCATGTTATTGCCAGTTGT
CTTGGTGTTCCCCAACACAATATCCGCGTAATTACAAGAAGGGTTGGAGGTGGCTTTGGGGGAAAGGGAGTCAGATCAATGCCTGTATCC
ACTGCCTGTGCATTAGCAGCATACAAATTAAGACGGCCTGTCAGGATATGCGTCAACCGGAACACTGACATGATAATGACAGGAGGACGA
CACCCAATGAAAGTAACATACAGTGTAGGATACAAATCTAGCGGAAAGATCACAGCATTACATCTAGATATATTGATAAATGCCGGGATC
ACAGAAGATATAAGCCCCATTGTACCATCAAATGTGATAAAAGCACTAAAAAAATATGATTGGGGTGCCTTATCTTTCAATGTAAAACTG
TGCAAGACGAATCTTTCCAGCAAATCAGCTATGCGGGCCCCTGGTGAAGTGCAAGGATCTTATATCGCCGAAGCTATAATGGAGCACGTT
GCAGGTTTACTCTCGATGGAGGTGGACTCAGTCAGAAACAAAAATTTCCATACATTTGAAAGCCTTAACTTATTCTATGATAACATTGTA
GCAGCAGGAGAATATACATTGCCTAGTATCATGGATAAGTTGGCAGTGTCCTCGAGCTTTTTCCAACGAAGCAAGATGATAGAACAGTTC
AACCAGAATAACACATGGAAGAAAAGGGGTATTTCTCGAGTGCCAATTGTGTATGAAGTTATGCAACGACCAACCTCAGGAAAAGTCAGT
ATTCTACTAAGATGGATCGATCGTAGTAGAGGAAAAGTCAGTATTCTGCAAGTGTCCTCGAGCTATTTACAAAGGTTAGACAGATGACTG
CATATGCTCTTGGTTTAATTGATAGTAGTTGGGCTGAAGACCTCGTGGAGAAAGTTCGAGTCATACAAGCAGACACCTTGAGCTTAGTGC
AGGCTGGGTTTACAGCTGGAAGCACTACATCGGAAACAAGCTGTGAAGCTGTTAGACTTTGCTGTGATGTATTGGTTGAAAGACTAACCC
CTTTGAAGAAACAGTTGCAGGAACAAAATGGCGCTGTTGATTGGCCAATGCTGATTCGCCAGGCACAAACGCAATCAGTAAGCTTAGCTG
CAAATTCTTATTATGTACCAAAATTCGGTTCCAGGAGTTATTTGAACTTTGGCGCTGCTGTCAGTGAGGTGGAGATTAATATTCTGACTG
GAGAGACTGCCATTTTGCAATCGGATATCATTTATGACTGCGGGCAAAGCTTGAATCCAGCCGTTGATTTGGGACAGATTGAAGGGGCTT
TTGTACAGGGAATCGGATTTTTCATGCACGAAGAATATCTTACAAACAAAGACGGGTTAATGGTCTCGAATAGCACTTGGACATACAAGA
TCCCAACTATTGACACCATACCTCAGAATTTCAATGTTCATGTGGTAAACAGTGGACATAACGAAAAACGTGTTCTCTCGTCTAAAGCAT
CTGGTGAACCGCCGCTGCTTCTGGCAGCTTCAGTCCACTGTGCAGCAAGAGCAGCCGTTAAAGCAGCACGCGAACAGCTCAAACTATGGG
GCAAGCTTGGCGGGTCTGTTTCAGAATTCTATCTAGACGTCCCCGCCATATTACCCGTTTTGAAGACACAGTGTGGCCTGGATTATGTGG
AAAAATACTTGGAAACTTTGCTGGCTCAGAAATCTAACTAAAAGTGCTTCAACATGCATCTCAAATGATATTGAACTATGTTGCTCGGAC
TCTCCAGCATATTGCATATGCTGTGTCGGTTTCTAAAAAATACACTATTTTTTGGACGACCTAACATACATTTGGGGGTATTTTTGAGAA
GTCCGAACAACATAGATAATTAATACTTGTTTAATGTATATCTTAAAGAATCTGAACTGTTCTGTTTAAAGAAATTGTGAGTTAAAGTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ao5 aldehyde oxidase 5pseudogene
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E747179
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 6 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)